SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcription repressor of the multidrug-resistance [gene|795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|mdtR]-[gene|search|mdtP ]operon
17.26 kDa
protein length
155 aa Sequence Blast
gene length
468 bp Sequence Blast
regulation of the multidrug-resistance [gene|795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|mdtR]-[gene|search|mdtP ]operon
transcription repressor ([SW|MarR family])

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • Gene

    3,374,492 3,374,959

    The protein

    Protein family

  • [SW|MarR family]
  • [SW|Domains]

  • [SW|HTH marR-type domain] (aa 4-140) (according to UniProt)
  • Structure

  • [PDB|1S3J]
  • Expression and Regulation



    regulatory mechanism

  • [protein|795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|MdtR]: repression, [Pubmed|19286808], in [regulon|795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|MdtR regulon]
  • view in new tab

    Biological materials


  • MGNA-B595 (yusO::erm), available at the [ NBRP B. subtilis, Japan]
  • GP1115 (spc), available in [SW|Jörg Stülke]'s lab
  • BKE32870 ([gene|795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|mdtR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCATTTCCCCTCTGT, downstream forward: _UP4_CAAAACATGAAAAGAGGAAA
  • BKK32870 ([gene|795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|mdtR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCATTTCCCCTCTGT, downstream forward: _UP4_CAAAACATGAAAAGAGGAAA
  • References

  • 19286808