SubtiBank SubtiBank
dltA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

dltA

D-alanyl-D-alanine carrier protein ligase, alanylation of teichoic acid provides some resistance against positively charged antimicrobial peptides
locus
BSU38500
pI
4.93
mw
55.64 kDa
protein length
503 aa Sequence Blast
gene length
1512 bp Sequence Blast
function
biosynthesis of teichoic acid
product
D-alanyl-D-alanine carrier protein ligase
essential
no
ec
6.1.1.13
synonyms
ipa-5r,dae

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.4|Biosynthesis of teichoic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.3|Biosynthesis of teichoic acid]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    3,952,275 3,953,786

    Phenotypes of a mutant

  • increased sensitivity to lysozyme [Pubmed|21856855]
  • more sensitive to nisin [Pubmed|23980836]
  • The protein

    Catalyzed reaction/ biological activity

  • ATP + D-alanine + poly(ribitol phosphate) = AMP + diphosphate + O-D-alanyl-poly(ribitol phosphate) (according to Swiss-Prot)
  • Protein family

  • [SW|ATP-dependent AMP-binding enzyme family] (according to UniProt)
  • Structure

  • [PDB|3E7X]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|459ED28A98F4EC7E8A9016C742DC8EB5C26B5E65|ywzH]-[gene|795CD64B65D7CBF26E5F706C7617196CC6FCF864|dltA]-[gene|1B9BAEBE029BE9D4AD7E49C38B1E6DB5E8F4D4D3|dltB]-[gene|862D977CF1E185597329A1EF0915485F72482A03|dltC]-[gene|D178EC8A1FF22C99C437E01FC4843C5176564992|dltD]-[gene|2FB3F09DA60A40212FE20217A64DAE714AB807CF|dltE]
    description
    [Pubmed|29794222]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|7797557], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|14762009], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV]: sigma factor, [Pubmed|21926231], in [regulon|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV regulon]
  • regulatory mechanism

  • [protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb]: activation, [Pubmed|16306698], in [regulon|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb regulon]
  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|7797557], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • expression is reduced in a [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV] mutant [Pubmed|21926231]
  • the mRNA is processed between [gene|459ED28A98F4EC7E8A9016C742DC8EB5C26B5E65|ywzH] and [gene|795CD64B65D7CBF26E5F706C7617196CC6FCF864|dltA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • BKE38500 ([gene|795CD64B65D7CBF26E5F706C7617196CC6FCF864|dltA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATAGTTATTCTCTCTC, downstream forward: _UP4_CGCATTGGCGAAGAGGTTCT
  • BKK38500 ([gene|795CD64B65D7CBF26E5F706C7617196CC6FCF864|dltA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATAGTTATTCTCTCTC, downstream forward: _UP4_CGCATTGGCGAAGAGGTTCT
  • labs

  • [SW|Mohamed Marahiel], Marburg University, Germany [http://www.uni-marburg.de/fb15/fachgebiete/bio/marahiel?language_sync=1 homepage]
  • References

    Reviews

  • 24819367
  • Original publications

  • 14762009,15955059,18784082,23980836,7797557,19324056,16306698,21856855,21926231,29069433,29794222,30283133