SubtiBank SubtiBank
yoyC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yoyC

unknown
locus
BSU_19479
pI
5.91
mw
11.00 kDa
protein length
gene length
279 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,122,672 2,122,950

    Expression and Regulation

    Operons

    genes
    [gene|7922A49FBC7CCDC8C585EF6E67D7CC9CC91059F7|yoyC]-[gene|63EC848DB7CC4464B070E65D2C9288851B08BBE3|yojF]-[gene|8106404D9D2CFA0825E1284D47CC7198D8A20E5D|bshB2]
    description
    (major transcript) [Pubmed|23894131,20308541]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23894131], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|23894131], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • ''[protein|search|yoyC]'': induced by diamide stess (thiol depletion) ([protein|search|Spx]) [Pubmed|23894131]
  • view in new tab

    genes
    [gene|FBF1A8C92149A216D8A46F9E02898D7C5C448E2A|yojE]-[gene|7922A49FBC7CCDC8C585EF6E67D7CC9CC91059F7|yoyC]-[gene|63EC848DB7CC4464B070E65D2C9288851B08BBE3|yojF]-[gene|8106404D9D2CFA0825E1284D47CC7198D8A20E5D|bshB2]
    description
    [Pubmed|23894131]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23894131], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • ''[protein|search|yoyC]'': induced by diamide stess (thiol depletion) ([protein|search|Spx]) [Pubmed|23894131]
  • view in new tab

    Biological materials

    Mutant

  • BKE19479 ([gene|7922A49FBC7CCDC8C585EF6E67D7CC9CC91059F7|yoyC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19479 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTCTTGCTCCTTTATG, downstream forward: _UP4_AAAGAAGAAAGAGGGGAGCA
  • BKK19479 ([gene|7922A49FBC7CCDC8C585EF6E67D7CC9CC91059F7|yoyC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19479 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTCTTGCTCCTTTATG, downstream forward: _UP4_AAAGAAGAAAGAGGGGAGCA
  • References

    Operon and expression

  • 20308541,23894131