SubtiBank SubtiBank
yoaF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yoaF

unknown
locus
BSU_18580
pI
5.51
mw
10.97 kDa
protein length
gene length
294 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    2,027,509 2,027,802

    Expression and Regulation

    Operons

    genes
    [gene|78B66D5B9848D8247D8B9A0DE8923F50F8FCDB46|yoaF]
    description
    [Pubmed|11866510]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|11866510], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulation

  • induced by alkali shock ([protein|search|SigW]) [Pubmed|11866510]
  • view in new tab

    genes
    [gene|628CCADB3C9A5F8A128C44ADE1DFDC2FC6B3CD01|yoaE]-[gene|78B66D5B9848D8247D8B9A0DE8923F50F8FCDB46|yoaF]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE18580 ([gene|78B66D5B9848D8247D8B9A0DE8923F50F8FCDB46|yoaF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTATGCCTCCATTAT, downstream forward: _UP4_TAAAACAAATCTGAGGAGAG
  • BKK18580 ([gene|78B66D5B9848D8247D8B9A0DE8923F50F8FCDB46|yoaF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTATGCCTCCATTAT, downstream forward: _UP4_TAAAACAAATCTGAGGAGAG
  • References

  • 11866510