SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to S-adenosyl-L-methionine-dependent methyltransferase
28.07 kDa
protein length
244 aa Sequence Blast
gene length
735 bp Sequence Blast
putative S-adenosyl-L-methionine-dependent methyltransferase

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    4,097,416 4,098,150

    The protein

    Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • Structure

  • [PDB|3DLC] (from Methanococcus maripaludis, corresponds to aa 21 ... 193, 30% identity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20185509], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|15101989], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed by glucose (8-fold) [Pubmed|12850135]
  • view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20185509], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|15101989], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed by glucose (8-fold) [Pubmed|12850135]
  • view in new tab

    Biological materials


  • MGNA-B690 (yxbB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE39890 ([gene|787BB72119DB1321A8281D7C46FED28CAEDBC97C|yxbB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCAGCATCCTCCTTA, downstream forward: _UP4_AAAGAAAAGGAAGGTGCATT
  • BKK39890 ([gene|787BB72119DB1321A8281D7C46FED28CAEDBC97C|yxbB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCAGCATCCTCCTTA, downstream forward: _UP4_AAAGAAAAGGAAGGTGCATT
  • References

  • 10746760,18083814,12618455,10498721,12618455,15101989,12850135,20185509,20525796,21815947