SubtiBank SubtiBank
yxbB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxbB

similar to S-adenosyl-L-methionine-dependent methyltransferase
locus
BSU_39890
pI
4.57
mw
28.07 kDa
protein length
244 aa Sequence Blast
gene length
735 bp Sequence Blast
function
unknown
product
putative S-adenosyl-L-methionine-dependent methyltransferase
essential
no
synonyms
yxaP

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,097,416 4,098,150

    The protein

    Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • Structure

  • [PDB|3DLC] (from Methanococcus maripaludis, corresponds to aa 21 ... 193, 30% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|787BB72119DB1321A8281D7C46FED28CAEDBC97C|yxbB]-[gene|88B01CC87394AEE693A98574F9343EBF99F0D60E|yxbA]-[gene|A15368CD02487EBC1AF999FED34672E38167BCB2|yxnB]
    description
    [Pubmed|20185509]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20185509], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|15101989], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed by glucose (8-fold) [Pubmed|12850135]
  • view in new tab

    genes
    [gene|787BB72119DB1321A8281D7C46FED28CAEDBC97C|yxbB]-[gene|88B01CC87394AEE693A98574F9343EBF99F0D60E|yxbA]-[gene|A15368CD02487EBC1AF999FED34672E38167BCB2|yxnB]-[gene|9446D9C88CBBBC5A08495D8AA49A92A9F47F2C9B|asnH]-[gene|BF0E188249161B3CC24D223FDD48B820EBED8F55|yxaM]
    description
    [Pubmed|10746760]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20185509], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|15101989], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed by glucose (8-fold) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B690 (yxbB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1689 NBRP B. subtilis, Japan]
  • BKE39890 ([gene|787BB72119DB1321A8281D7C46FED28CAEDBC97C|yxbB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCAGCATCCTCCTTA, downstream forward: _UP4_AAAGAAAAGGAAGGTGCATT
  • BKK39890 ([gene|787BB72119DB1321A8281D7C46FED28CAEDBC97C|yxbB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCAGCATCCTCCTTA, downstream forward: _UP4_AAAGAAAAGGAAGGTGCATT
  • References

  • 10746760,18083814,12618455,10498721,12618455,15101989,12850135,20185509,20525796,21815947