SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


two-component system response regulator, controls gene expression in response to cell density (concentration of [protein|60D6EB02923D9ADE88F61A8CBBD882BA8BDD457E|ComX])
23.98 kDa
protein length
214 aa Sequence Blast
gene length
645 bp Sequence Blast
regulation of genetic competence and quorum sensing
two-component system response regulator

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Two-component system response regulators]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    3,252,804 3,253,448

    The protein

    Protein family

  • ComA family (according to Swiss-Prot)
  • Modification

  • phosphorylated by [protein|5A00E233F0B5A0DAB18D2ECC55527F1911987F86|ComP] on an Asp residue
  • Effectors of protein activity

  • phosphorylation activates DNA binding
  • DNA-binding activity of ComA is inhibited by [protein|242632B27E0E3AB15777E9FBA3FC746D00CE97F9|RapC] [Pubmed|12950917], [protein|4670F7C4CB9084A5BA478CAE238FA0F8C39F3A7E|RapD] [Pubmed|17227471], [protein|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|RapF] [Pubmed|15968044,22215984], [protein|BA85E2C2E2A6B76FAFA31EBDBF466324C9B021C8|RapH] [Pubmed|17581123] and [protein|C8BF3815578293542D14811C60F4CA78AACF73EB|RapK] [Pubmed|16816200]
  • Structure

  • [PDB|1U83]
  • [PDB|3ULQ] (structure of the complex between the DNA-binding C-terminal domain of [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA] with [protein|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|RapF]) [Pubmed|22215984]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2507523], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials


  • BKE31680 ([gene|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTCCTCCCTTTTAC, downstream forward: _UP4_CTTTAAATGTTGGGGGGTGT
  • BKK31680 ([gene|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTCCTCCCTTTTAC, downstream forward: _UP4_CTTTAAATGTTGGGGGGTGT
  • References


  • 20030732,12576575,30218468
  • Original Publications

  • 17227471,11133937,2116363,12067344,8387999,19202088,10094672,8643670,11267663,15968044,16816200,10447896,12950917,20302877,12270822,17581123,2507523,20208433,22215984,24130811,24425772,24788106,25598361,25757097,26582911,26787913,26927849,28033323