SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


subunit of ATP-dependent 5-oxoprolinase
27.39 kDa
protein length
257 aa Sequence Blast
gene length
774 bp Sequence Blast
detoxification of 5-oxoproline
subunit of 5-oxoprolinase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.7|Detoxification reactions]
  • Gene

    457,023 457,796

    Phenotypes of a mutant

  • no growth with 5-oxoproline as single source of nitrogen [pubmed|28830929]
  • reduced growth with ammonium as source of nitrogen due to the accumulation of toxic 5-oxoproline [pubmed|28830929]
  • The protein

    Catalyzed reaction/ biological activity

  • 5-oxoproline + ATP --> glutamate + ADP + Pi [pubmed|28830929]
  • Protein family

  • LamB/PxpA family (single member, according to UniProt)
  • Kinetic information

  • Km (5-oxoproline): 39 M [pubmed|28830929]
  • Structure

  • [PDB|1V6T] (from ''Pyrococcus horikoshii'', 52% identity)
  • Expression and Regulation



    regulatory mechanism

  • [protein|7DA9A79876C546B78B716A64706A3A3716018C2E|KipR]: repression, [Pubmed|9334321], in [regulon|7DA9A79876C546B78B716A64706A3A3716018C2E|KipR regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|9334321], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • induced in the presence of 5-oxoproline [pubmed|28830929]
  • view in new tab

    Biological materials


  • MGNA-C072 (ycsF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE04050 ([gene|77F758CE9A59AC41F283CB1F5099097386133799|pxpA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGAATCCCTCCTGCCAA, downstream forward: _UP4_TCAACATAAAGGAGGAACAA
  • BKK04050 ([gene|77F758CE9A59AC41F283CB1F5099097386133799|pxpA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGAATCCCTCCTGCCAA, downstream forward: _UP4_TCAACATAAAGGAGGAACAA
  • References

  • 9334321,25755103,28830929