SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


L-Ala-D/L-Glu epimerase
39.31 kDa
protein length
366 aa Sequence Blast
gene length
1101 bp Sequence Blast
cell wall metabolism
L-Ala-D/L-Glu epimerase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.5|Cell wall/ other]
  • Gene

    1,366,844 1,367,944

    The protein

    Catalyzed reaction/ biological activity

  • L-alanyl-L-glutamate --> L-alanyl-D-glutamate (according to UniProt)
  • Protein family

  • [SW|mandelate racemase/muconate lactonizing enzyme family] (according to UniProt)
  • Structure

  • [PDB|1TKK] (complex with substrate), [PDB|1JPM]
  • Expression and Regulation



    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • view in new tab

    Biological materials


  • MGNA-A741 (ykfB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE12980 ([gene|77EFC47449D8CC17651ED61C41AC605FCEF01270|ykfB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTTGTTTCGATTCGAATGA, downstream forward: _UP4_CTTTTGAAAGGGGAAAAAGA
  • BKK12980 ([gene|77EFC47449D8CC17651ED61C41AC605FCEF01270|ykfB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTTGTTTCGATTCGAATGA, downstream forward: _UP4_CTTTTGAAAGGGGAAAAAGA
  • References

  • 12618455,11747447,11747448,15301535,22392983