SubtiBank SubtiBank
skfF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

skfF

ABC transporter (permease), export of the spore killing factor
locus
BSU_01960
pI
9.22
mw
51.72 kDa
protein length
448 aa Sequence Blast
gene length
1344 bp Sequence Blast
function
export of the spore killing factor SkfA
product
ABC transporter (permease)
essential
no
synonyms
ybdB

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.2|Exporters] → [category|SW 1.2.1.2.3|Export of peptides]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.4|Prophage 1]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    217,697 → 219,040

    Phenotypes of a mutant

  • inactivation of ''[gene|77D93CAEF46EBBB9BAF570714445E194D5F2884E|skfF]'' reduces sporulation efficiency to 62.3% that of wild type cells [Pubmed|26735940]
  • The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|DDB0022F50999AC52809D651C9CC5A5FDC71302C|skfA]-[gene|F981C605C652D1A4429579A5F24608CE7F570834|skfB]-[gene|4DFF9924E07D834F37580D73E88451C1671C5111|skfC]-[gene|5886364199844356446C08F08664B301A714E74A|skfE]-[gene|77D93CAEF46EBBB9BAF570714445E194D5F2884E|skfF]-[gene|527AB8EAAF0A1AAD4E5B714B35ED9F78BECC17EC|skfG]-[gene|F31B12F80AFC3580FD33811A1C22E74F75DC1A85|skfH]
    description
    [Pubmed|16816204]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16452424], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [PubMed|14651647,15687200], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|15687200,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|16816204], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [http://www.ncbi.nlm.nih.gov/sites/entrez/14651647,15687200 PubMed]
  • additional information

  • Northern blotting during during phosphate limitation showed an intense 0.25 kb '[protein|search|skfA]'-specific transcript, and a weaker 6.5 kb '[protein|search|skfA]-[protein|search|skfB]-[protein|search|skfC]-[protein|search|skfE]-[protein|search|skfF]-[protein|search|skfG]-[protein|search|skfH]' transcript.
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C516 (ybdB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2514 NBRP B. subtilis, Japan]
  • BKE01960 (Δ[gene|77D93CAEF46EBBB9BAF570714445E194D5F2884E|skfF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTTTTCCTGACCTT, downstream forward: _UP4_TAGTGGTTATGTAGAGTTAT
  • BKK01960 (Δ[gene|77D93CAEF46EBBB9BAF570714445E194D5F2884E|skfF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTTTTCCTGACCTT, downstream forward: _UP4_TAGTGGTTATGTAGAGTTAT
  • References

    Reviews

  • 20955377
  • Original Publications

  • 10092453,12817086,16816204,14651647,15687200,15687200,17720793,11731129,17449691,18840696,26735940