SubtiBank SubtiBank
rbsR
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

rbsR

transcriptional repressor of the ribose operon
locus
BSU35910
pI
5.58
mw
35.70 kDa
protein length
326 aa Sequence Blast
gene length
978 bp Sequence Blast
function
regulation of ribose utilization
product
transcriptional repressor (LacI family)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.4|Utilization of ribose]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    3,701,411 → 3,702,391

    The protein

    Protein family

  • [SW|LacI family]
  • Expression and Regulation

    Operons

    genes
    [gene|77AEAC0F06B4D5F062D4A2740794B7BFDDA31096|rbsR]-[gene|C229BD2C00B169CF4A99482E65B3F749AD9D51D8|rbsK]-[gene|F0E6F191FAF8F279462B09BF1FE4C6C752A57803|rbsD]-[gene|AB4A686F62550F90F5BD8D27DAADC9C33F1DA1DB|rbsA]-[gene|F1258E31151E137A850811B0C851D473CEFFD43B|rbsC]-[gene|1D67888E79B09956F9258F4068546D8C67103549|rbsB]
    description
    [Pubmed|7921236]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7511775], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|7921236], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|7592460], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed upon transition into the stationary phase ([protein|search|AbrB]) [Pubmed|7592460]
  • view in new tab

    Biological materials

    Mutant

  • BKE35910 (Δ[gene|77AEAC0F06B4D5F062D4A2740794B7BFDDA31096|rbsR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAACAGCTCCTCCTTGTT, downstream forward: _UP4_AAGACGACAAGAAAGGAAGA
  • BKK35910 (Δ[gene|77AEAC0F06B4D5F062D4A2740794B7BFDDA31096|rbsR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAACAGCTCCTCCTTGTT, downstream forward: _UP4_AAGACGACAAGAAAGGAAGA
  • References

  • 16872404,16519689,22900538,7592460,12850135,7921236,7511775