SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


transcriptional repressor of the ribose operon
35.70 kDa
protein length
326 aa Sequence Blast
gene length
981 bp Sequence Blast
regulation of ribose utilization
transcriptional repressor ([SW|LacI family])

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of ribose]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    3,701,411 3,702,391

    The protein

    Protein family

  • [SW|LacI family]
  • [SW|Domains]

  • [SW|HTH lacI-type domain] (aa 1-56) (according to UniProt)
  • Structure

  • [PDB|3CTP] (from Alkaliphilus metalliredigens, 35% identity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7511775], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|7921236], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|7592460], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed upon transition into the stationary phase ([protein|search|AbrB]) [Pubmed|7592460]
  • view in new tab

    Biological materials


  • BKE35910 ([gene|77AEAC0F06B4D5F062D4A2740794B7BFDDA31096|rbsR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAACAGCTCCTCCTTGTT, downstream forward: _UP4_AAGACGACAAGAAAGGAAGA
  • BKK35910 ([gene|77AEAC0F06B4D5F062D4A2740794B7BFDDA31096|rbsR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAACAGCTCCTCCTTGTT, downstream forward: _UP4_AAGACGACAAGAAAGGAAGA
  • References

  • 16872404,16519689,22900538,7592460,12850135,7921236,7511775