SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to oxidoreductase
18.87 kDa
protein length
176 aa Sequence Blast
gene length
531 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    979,396 979,926

    The protein


  • [SW|Flavodoxin-like domain] (aa 3-162) (according to UniProt)
  • Structure

  • [PDB|4LA4] (from Pseudomonas sp., 34% identity)
  • Expression and Regulation



    additional information

  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] (the half-life of the mRNA increases from 4 to 41 min) [PubMed|21815947]
  • view in new tab

    Biological materials


  • MGNA-B472 (yhcB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE09020 ([gene|7797B0B66922D51B9D142DD2E5857836E47F015B|yhcB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAGGAAACCTCCCTGT, downstream forward: _UP4_GCAGGACAGTAAGGAGAGGT
  • BKK09020 ([gene|7797B0B66922D51B9D142DD2E5857836E47F015B|yhcB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAGGAAACCTCCCTGT, downstream forward: _UP4_GCAGGACAGTAAGGAGAGGT
  • References

  • 21815947