SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


split paralog of [protein|621357D1FB6AC1B0499732EFE226F982B26CE34E|RsbR] with [protein|00A19F2D960FAD4A6DA34D027828E1135A3BE218|YezB]
0.00 kDa
protein length
192 aa Sequence Blast
gene length
576 bp Sequence Blast
possible stressosome protein
split paralog of [protein|621357D1FB6AC1B0499732EFE226F982B26CE34E|RsbR] with [protein|00A19F2D960FAD4A6DA34D027828E1135A3BE218|YezB]

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    786,689 → 787,264

    Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B460 (yetI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE07170 (Δ[gene|778B0E3A524EFE38DE3917FA69F21563D525D1DA|yetI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGGTCTGTCTCCTTTTTC, downstream forward: _UP4_ATTGATACAAAACGGCACAG
  • BKK07170 (Δ[gene|778B0E3A524EFE38DE3917FA69F21563D525D1DA|yetI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGGTCTGTCTCCTTTTTC, downstream forward: _UP4_ATTGATACAAAACGGCACAG