SubtiBank SubtiBank
yetI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yetI

split paralog of [protein|621357D1FB6AC1B0499732EFE226F982B26CE34E|RsbR] with [protein|00A19F2D960FAD4A6DA34D027828E1135A3BE218|YezB]
locus
BSU07170
pI
0.00
mw
0.00 kDa
protein length
192 aa Sequence Blast
gene length
576 bp Sequence Blast
function
possible stressosome protein
product
split paralog of [protein|621357D1FB6AC1B0499732EFE226F982B26CE34E|RsbR] with [protein|00A19F2D960FAD4A6DA34D027828E1135A3BE218|YezB]
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    Coordinates
    786,689 → 787,264

    Expression and Regulation

    Operons

    genes
    [gene|778B0E3A524EFE38DE3917FA69F21563D525D1DA|yetI]-[gene|00A19F2D960FAD4A6DA34D027828E1135A3BE218|yezB]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B460 (yetI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1459 NBRP B. subtilis, Japan]
  • BKE07170 (Δ[gene|778B0E3A524EFE38DE3917FA69F21563D525D1DA|yetI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGGTCTGTCTCCTTTTTC, downstream forward: _UP4_ATTGATACAAAACGGCACAG
  • BKK07170 (Δ[gene|778B0E3A524EFE38DE3917FA69F21563D525D1DA|yetI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGGTCTGTCTCCTTTTTC, downstream forward: _UP4_ATTGATACAAAACGGCACAG