SubtiBank SubtiBank
aroD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

aroD

shikimate dehydrogenase
locus
BSU_25660
pI
6.08
mw
30.49 kDa
protein length
280 aa Sequence Blast
gene length
843 bp Sequence Blast
function
biosynthesis of aromatic amino acids
product
shikimate dehydrogenase
essential
no
ec
1.1.1.25
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.13|Biosynthesis/ acquisition of aromatic amino acids]
  • Gene

    Coordinates
    2,644,630 2,645,472

    Phenotypes of a mutant

  • slow growth [pubmed|31358606]
  • 50% reduction in mo5U tRNA levels (because prephenate, the product formed by [protein|5C2F7F9F5FCBFEDF77AC41725EFDA0FAF0FC3BC1|AroH], is used as hydroxyl donor for partial ho5U synthesis) [pubmed|31358606]
  • The protein

    Catalyzed reaction/ biological activity

  • NADP+ + shikimate --> 3-dehydroshikimate + H+ + NADPH (according UniProt)
  • Protein family

  • shikimate dehydrogenase family (single member, according to UniProt)
  • Structure

  • [PDB|2HK8] (from ''Aquifex aeolicus'', 42% identity, 61% similarity) [Pubmed|17649975]
  • Expression and Regulation

    Operons

    genes
    [gene|722FD63050EED803C859FFD61338C02D5BB4CC1C|yqeG]-[gene|959C0ED7B9DA50F0EADCF1565405B878D36DA206|yqeH]-[gene|776D79C45DADA631D4A75B0773CFF471A87D9EEC|aroD]-[gene|7774FC36BAEAD33EDD48CB77DA0B5E7E0EA38CA2|yqeI]-[gene|AA4BB1F5B58371D536A6BBA86F6ECB5E5BFB12A8|nadD]-[gene|247C47AC70A0EA53E625871D9BC463A06E6B05FB|yqeK]-[gene|B9D5E9B566D28423232C1A28C966CDEA0E5A6B78|yqeL]-[gene|7F63251ABC07F6C11C57B62CBB948240B08D0181|yqeM]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE25660 ([gene|776D79C45DADA631D4A75B0773CFF471A87D9EEC|aroD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25660 BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_TTTCATACACCTCTCCCCTT, downstream forward: _UP4_ATAGGAAAATTAGGAGGAAC
  • BKK25660 ([gene|776D79C45DADA631D4A75B0773CFF471A87D9EEC|aroD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATACACCTCTCCCCTT, downstream forward: _UP4_ATAGGAAAATTAGGAGGAAC
  • References

  • 6811271,24628944,22383849,31358606