SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


shikimate dehydrogenase
30.49 kDa
protein length
280 aa Sequence Blast
gene length
843 bp Sequence Blast
biosynthesis of aromatic amino acids
shikimate dehydrogenase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of aromatic amino acids]
  • Gene

    2,644,630 2,645,472

    The protein

    Catalyzed reaction/ biological activity

  • Shikimate + NADP+ = 3-dehydroshikimate + NADPH (according to Swiss-Prot)
  • Protein family

  • shikimate dehydrogenase family (according to Swiss-Prot)
  • Structure

  • [PDB|2HK8] (from ''Aquifex aeolicus'', 42% identity, 61% similarity) [Pubmed|17649975]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE25660 ([gene|776D79C45DADA631D4A75B0773CFF471A87D9EEC|aroD]::erm trpC2) available at [ BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_TTTCATACACCTCTCCCCTT, downstream forward: _UP4_ATAGGAAAATTAGGAGGAAC
  • BKK25660 ([gene|776D79C45DADA631D4A75B0773CFF471A87D9EEC|aroD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATACACCTCTCCCCTT, downstream forward: _UP4_ATAGGAAAATTAGGAGGAAC
  • References

  • 6811271,24628944,22383849