SubtiBank SubtiBank
yjhA [2019-03-13 18:44:41]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yjhA [2019-03-13 18:44:41]

23.83 kDa
protein length
213 aa Sequence Blast
gene length
642 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    1,289,298 1,289,939

    The protein


  • [SW|DUF4352] (aa 64 ... 194) (according to UniProt)
  • Structure

  • [PDB|3CFU]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • MGNA-A353 (yjhA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE12180 ([gene|772A05040C46912B9FDEE4F4F817CE0C92EC7C1A|yjhA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTGTTCCCCCATCTA, downstream forward: _UP4_TAGATGCTAATTTACAGTTG
  • BKK12180 ([gene|772A05040C46912B9FDEE4F4F817CE0C92EC7C1A|yjhA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTGTTCCCCCATCTA, downstream forward: _UP4_TAGATGCTAATTTACAGTTG
  • References

  • 27766092