SubtiBank SubtiBank
yjhA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjhA

lipoprotein
locus
BSU_12180
pI
5.29
mw
23.83 kDa
protein length
213 aa Sequence Blast
gene length
642 bp Sequence Blast
function
unknown
product
lipoprotein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,289,298 1,289,939

    The protein

    [SW|Domains]

  • [SW|DUF4352] (aa 64 ... 194) (according to UniProt)
  • Structure

  • [PDB|3CFU]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|772A05040C46912B9FDEE4F4F817CE0C92EC7C1A|yjhA]-[gene|FF6A150806407E7D10C090FA2CDB521DDC7811F9|yjhB]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|772A05040C46912B9FDEE4F4F817CE0C92EC7C1A|yjhA]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A353 (yjhA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/353 NBRP B. subtilis, Japan]
  • BKE12180 ([gene|772A05040C46912B9FDEE4F4F817CE0C92EC7C1A|yjhA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTGTTCCCCCATCTA, downstream forward: _UP4_TAGATGCTAATTTACAGTTG
  • BKK12180 ([gene|772A05040C46912B9FDEE4F4F817CE0C92EC7C1A|yjhA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTGTTCCCCCATCTA, downstream forward: _UP4_TAGATGCTAATTTACAGTTG
  • References

  • 27766092