SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


HPr kinase/ phosphorylase
34.55 kDa
protein length
310 aa Sequence Blast
gene length
933 bp Sequence Blast
carbon catabolite repression,phosphorylation of [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr] and [protein|A269774F2FDC94F93BA5F1360FFFE754B50383AD|Crh] proteins at Ser46
[protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr] kinase/ phosphorylase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of transcription factor (other than two-component system)]
  • Gene

    3,594,242 3,595,174

    Phenotypes of a mutant

  • no carbon catabolite repression [Pubmed|9570401]
  • delay in spore [SW|germination] [Pubmed|26381121]
  • The protein

    Catalyzed reaction/ biological activity

  • [HPr protein]-L-serine + ATP --> [HPr protein]-O-phospho-L-serine + ADP + H+ (according to UniProt)
  • [HPr protein]-O-phospho-L-serine + H+ + phosphate --> [HPr protein]-L-serine + diphosphate (according to UniProt)
  • Protein family

  • HPrK/P family (single member, according to UniProt)
  • Structure

  • [PDB|1KNX] (from Mycoplasma pneumoniae) [pubmed|12589763]
  • [PDB|1KKM] (complex of Lactobacillus casei HprK with B. subtilis [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr]-Ser-P)
  • [PDB|1KKL] (complex of Lactobacillus casei HprK with B. subtilis [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr])
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23667565], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials


  • MGNA-A328 (hprK::erm), available at the [ NBRP B. subtilis, Japan]
  • GP202 (Δ[gene|771F205F818A755A661B8E1C95365A4F6AEB05C7|hprK]::spc) [Pubmed|12055300], available in [SW|Jörg Stülke]'s lab
  • GP858 (Δ[gene|771F205F818A755A661B8E1C95365A4F6AEB05C7|hprK]::aphA3) [Pubmed|18757537], available in [SW|Jörg Stülke]'s lab
  • GP82 (Δ[gene|771F205F818A755A661B8E1C95365A4F6AEB05C7|hprK]::cat) [Pubmed|21992469], available in [SW|Jörg Stülke]'s lab
  • BKE35000 (Δ[gene|771F205F818A755A661B8E1C95365A4F6AEB05C7|hprK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGATATGTTCCTCCTGTT, downstream forward: _UP4_CAAGAAGAATAGGAGTTGGC
  • BKK35000 (Δ[gene|771F205F818A755A661B8E1C95365A4F6AEB05C7|hprK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGATATGTTCCTCCTGTT, downstream forward: _UP4_CAAGAAGAATAGGAGTTGGC
  • Expression vectors

  • for expression/ purification from ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], in [SW|pGP380]: pGP642, available in [SW|Jörg Stülke]'s lab
  • for expression/ purification of mutant HprK-G158A from ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], in [SW|pGP380]: pGP650, available in [SW|Jörg Stülke]'s lab
  • for expression/ purification from ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP205, available in [SW|Jörg Stülke]'s lab [pubmed|12055300]
  • for expression, purification of the N-terminal domain in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP218, available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP201 (in [SW|pAC5], [Pubmed|12055300]) available in [SW|Jörg Stülke]'s lab
  • pGP202 (in [SW|pAC6], [Pubmed|12055300]) available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in [SW|Jörg Stülke]'s lab [Pubmed|12055300]
  • labs

  • [SW|Jörg Stülke], University of Göttingen, Germany [ Homepage]
  • [SW|Anne Galinier], University of Marseille, France
  • References


  • 12837773,15023355,18628769
  • General Analysis, Physiology

  • 9570401,9465101,12123463,18757537,22001508,23667565,26381121
  • Structural Analysis of HPrK

  • 11904409,12589763,12359875,17878158
  • Enzymatic Properties, Mutation Analysis

  • 12359880,11483496,12055300,10636874,12411438,11796714,12009882,12779331
  • HprK as a Target For Antimicrobial Compounds

  • 15084125