SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


membrane-anchored protein quality control protease, serine protease Do
47.55 kDa
protein length
449 aa Sequence Blast
gene length
1350 bp Sequence Blast
protein quality control
serine protease Do

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Protein quality control]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,357,936 1,359,285

    The protein

    Catalyzed reaction/ biological activity

  • required for folding of the secreted protein [protein|6EA4D86FA1EA6388054A4D863EB576187CD5AEEE|YqxI] [Pubmed|23937099]
  • Acts on substrates that are at least partially unfolded. The cleavage site P1 residue is normally between a pair of hydrophobic residues, such as Val-|-Val (according to UniProt)
  • Protein family

  • Peptidase S1C family (with [protein|796216BE9CD6DADFEADC29497253C81BF496A2ED|HtrB] and [protein|75B8C37E589C855D2BAD7FB51B9600E161ACFBD3|HtrC], according to UniProt)
  • Paralogous protein(s)

  • [protein|75B8C37E589C855D2BAD7FB51B9600E161ACFBD3|HtrC]
  • [SW|Domains]

  • cytoplasmic domain (aa 1 - 44) (according to UniProt)
  • transmembrane helix (aa 45 - 67) (according to UniProt)
  • extracellular domain (aa 68 - 479) (according to UniProt)
  • [SW|PDZ domain] (aa 342 - 441) (according to UniProt)
  • Structure

  • [PDB|3QO6] (from Arabidopsis thaliana, 37% identity) [pubmed|21532594]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • extracellular (signal peptide) [Pubmed|18957862]
  • randomly distributed in foci throughout the cell surface [Pubmed|22307758]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10692364], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|A40CD2C23A19860342F440284302EFFDAC09E88A|CssR]: activation, [Pubmed|11555295], in [regulon|A40CD2C23A19860342F440284302EFFDAC09E88A|CssR regulon]
  • regulation

  • expressed under conditions of secretion stress ([protein|A40CD2C23A19860342F440284302EFFDAC09E88A|CssR]) [Pubmed|11555295]
  • additional information

  • [protein|76FA52D5A5F9FCA14BA9B45872FE3D99D89B211B|HtrA] is subject to degradation by [protein|DC0FDCA3FA6742B023E6877CE9554AA1D47012BB|WprA] and other extracellular proteases [PubMed|24362423]
  • view in new tab

    Biological materials


  • 1A933 (no resistance), [Pubmed|10692364], available at [ BGSC]
  • BKE12900 ([gene|76FA52D5A5F9FCA14BA9B45872FE3D99D89B211B|htrA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATGTTCACTCCGTTTC, downstream forward: _UP4_TAAGACATAATGCCTCAGGC
  • BKK12900 ([gene|76FA52D5A5F9FCA14BA9B45872FE3D99D89B211B|htrA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATGTTCACTCCGTTTC, downstream forward: _UP4_TAAGACATAATGCCTCAGGC
  • References


  • 22688815,21326199,25212246,31001739
  • Original publications

  • 17600057,12270824,11555295,18957862,10692364,21624103,22307758,22092710,24362423,23937099,24115457,11133960,21532594,32111210