SubtiBank SubtiBank
htrA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

htrA

membrane-anchored protein quality control protease, serine protease Do
locus
BSU_12900
pI
4.70
mw
47.55 kDa
protein length
449 aa Sequence Blast
gene length
1350 bp Sequence Blast
function
protein quality control
product
serine protease Do
essential
no
synonyms
ykdA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.1|Protein quality control]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,357,936 1,359,285

    The protein

    Catalyzed reaction/ biological activity

  • required for folding of the secreted protein [protein|6EA4D86FA1EA6388054A4D863EB576187CD5AEEE|YqxI] [Pubmed|23937099]
  • Acts on substrates that are at least partially unfolded. The cleavage site P1 residue is normally between a pair of hydrophobic residues, such as Val-|-Val (according to UniProt)
  • Protein family

  • Peptidase S1C family (with [protein|796216BE9CD6DADFEADC29497253C81BF496A2ED|HtrB] and [protein|75B8C37E589C855D2BAD7FB51B9600E161ACFBD3|HtrC], according to UniProt)
  • Paralogous protein(s)

  • [protein|75B8C37E589C855D2BAD7FB51B9600E161ACFBD3|HtrC]
  • [SW|Domains]

  • cytoplasmic domain (aa 1 - 44) (according to UniProt)
  • transmembrane helix (aa 45 - 67) (according to UniProt)
  • extracellular domain (aa 68 - 479) (according to UniProt)
  • [SW|PDZ domain] (aa 342 - 441) (according to UniProt)
  • Structure

  • [PDB|3QO6] (from Arabidopsis thaliana, 37% identity) [pubmed|21532594]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • extracellular (signal peptide) [Pubmed|18957862]
  • randomly distributed in foci throughout the cell surface [Pubmed|22307758]
  • Expression and Regulation

    Operons

    genes
    [gene|76FA52D5A5F9FCA14BA9B45872FE3D99D89B211B|htrA]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10692364], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|A40CD2C23A19860342F440284302EFFDAC09E88A|CssR]: activation, [Pubmed|11555295], in [regulon|A40CD2C23A19860342F440284302EFFDAC09E88A|CssR regulon]
  • regulation

  • expressed under conditions of secretion stress ([protein|A40CD2C23A19860342F440284302EFFDAC09E88A|CssR]) [Pubmed|11555295]
  • additional information

  • [protein|76FA52D5A5F9FCA14BA9B45872FE3D99D89B211B|HtrA] is subject to degradation by [protein|DC0FDCA3FA6742B023E6877CE9554AA1D47012BB|WprA] and other extracellular proteases [PubMed|24362423]
  • view in new tab

    Biological materials

    Mutant

  • 1A933 (no resistance), [Pubmed|10692364], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A933&Search=1A933 BGSC]
  • BKE12900 ([gene|76FA52D5A5F9FCA14BA9B45872FE3D99D89B211B|htrA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATGTTCACTCCGTTTC, downstream forward: _UP4_TAAGACATAATGCCTCAGGC
  • BKK12900 ([gene|76FA52D5A5F9FCA14BA9B45872FE3D99D89B211B|htrA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATGTTCACTCCGTTTC, downstream forward: _UP4_TAAGACATAATGCCTCAGGC
  • References

    Reviews

  • 22688815,21326199,25212246,31001739
  • Original publications

  • 17600057,12270824,11555295,18957862,10692364,21624103,22307758,22092710,24362423,23937099,24115457,11133960,21532594