SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


glycine betaine/carnitine/choline/arsenobetaine/arsenocholine [SW|ABC transporter]
24.40 kDa
protein length
229 aa Sequence Blast
gene length
690 bp Sequence Blast
compatible solute transport
glycine betaine/carnitine/choline/arsenobetaine/arsenocholine [SW|ABC transporter]

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of compatible solutes for osmoprotection]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,467,546 3,468,235

    The protein

    Catalyzed reaction/ biological activity

  • uptake of glycine betaine, arsenocholine and arsenobetaine [pubmed|29159878]
  • Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • [SW|CysTW subfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|1532EC3D741C5AB3D0B642741218FAE00AD460FA|OpuBD]
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation



    regulatory mechanism

  • [protein|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|OpcR]: repression, [Pubmed|23960087], in [regulon|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|OpcR regulon]
  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • induced by salt stress [Pubmed|23960087,10216873]
  • induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials


  • BKE33800 ([gene|76C8D6BF2CA1FA5E7392C52FFD55FD01EF5AB9DC|opuCD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCATATGATCCACCTCTT, downstream forward: _UP4_TAAATACAACAGAGGTGGTT
  • BKK33800 ([gene|76C8D6BF2CA1FA5E7392C52FFD55FD01EF5AB9DC|opuCD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCATATGATCCACCTCTT, downstream forward: _UP4_TAAATACAACAGAGGTGGTT
  • References


  • 27935846
  • Original publications

  • 10092453,9925583,10216873,21296969,23960087,23646920,29159878