SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


sporulation-specific penicillin-binding protein 5*, D-alanyl-D-alanine carboxypeptidase
42.92 kDa
protein length
382 aa Sequence Blast
gene length
1149 bp Sequence Blast
penicillin-binding protein 5*, D-alanyl-D-alanine carboxypeptidase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Penicillin-binding proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,423,383 2,424,531

    Phenotypes of a mutant

  • inactivation of ''[gene|76825D77907E8CE47B17ED56D7E2A348B1ADA5EC|dacB]'' reduces sporulation efficiency to 19.3% that of wild type cells [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • modifies degree of cross-linking of glycan strands in peptidoglycan
  • Preferential cleavage: (Ac)(2)-L-Lys-D-Ala-|-D-Ala. Also transpeptidation of peptidyl-alanyl moieties that are N-acyl substituents of D-alanine (according to UniProt)
  • Protein family

  • [SW|Peptidase S11 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|F7AD78F9AB98A150E8CDFC1D01A9F938FF9F8BD1|DacF]
  • Structure

  • [PDB|3MFD] (beta-lactamase superfamily domain)
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,7528199], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|15699190,7528199]
  • view in new tab

    Biological materials


  • MGNA-A098 (dacB::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A744 ( ''dacB''::''cat''), [Pubmed|1644769], available at [ BGSC]
  • 1A745 ( ''dacB''::''cat''), [Pubmed|1644769], available at [ BGSC]
  • BKE23190 ([gene|76825D77907E8CE47B17ED56D7E2A348B1ADA5EC|dacB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTGCTCACGTCCTTG, downstream forward: _UP4_CTGAATGCGGCAGGCGGAGC
  • BKK23190 ([gene|76825D77907E8CE47B17ED56D7E2A348B1ADA5EC|dacB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTGCTCACGTCCTTG, downstream forward: _UP4_CTGAATGCGGCAGGCGGAGC
  • References


  • 18266855
  • Original publications

  • 10498740,9864321,1548223,7642500,19542328,7528199,15699190,22123250,26735940