SubtiBank SubtiBank
flgK

flgK

flagellar hook-filament junction proteins
locus
BSU_35410
pI
4.38
mw
54.19 kDa
protein length
507 aa Sequence Blast
gene length
1524 bp Sequence Blast
function
motility and chemotaxis
product
flagellar hook-filament junction proteins
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.2|Flagellar proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    3,638,245 3,639,768

    The protein

    Protein family

  • [SW|Flagella basal body rod proteins family] (according to UniProt)
  • [SW|Localization]

  • extracellular (no signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|45F27C0789199626BA90D2C69E8F13525C911478|comFA]-[gene|D290247A43280532947B707F3AF388D7A7F404D3|comFB]-[gene|04D9D70C0BCFDCBD00B5156908C348135080A9C2|comFC]-[gene|049B1EBF64F0EBC04CE6D529C8EDB0B6B2184DF5|yvyF]-[gene|F03144BF8A187C8931938A21433431B8961E8EE7|flgM]-[gene|6F4CD36D4C1EE99EF7A503F44F53AEB8EFFEAB7F|yvyG]-[gene|767ADBEF1B40CB3C74116CEA8CFB2FAF19C1FE7B|flgK]-[gene|82AB04023BCB57967C7501E6AEAC4BB593AA6480|flgL]-[gene|E5A59D2AF53FA220BA98D9653589A8F0D24F75B8|yviE]-[gene|6A6CBD75DCC33C804F853F47D37773930D398CFE|fliW]-[gene|93F328524989597C7D2329B25E665496C9631E87|csrA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8412657], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|8045879], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|8412657], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|21736639], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|19898538], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • view in new tab

    genes
    [gene|F03144BF8A187C8931938A21433431B8961E8EE7|flgM]-[gene|6F4CD36D4C1EE99EF7A503F44F53AEB8EFFEAB7F|yvyG]-[gene|767ADBEF1B40CB3C74116CEA8CFB2FAF19C1FE7B|flgK]-[gene|82AB04023BCB57967C7501E6AEAC4BB593AA6480|flgL]
    description
    [Pubmed|21736639]
    view in new tab

    genes
    [gene|049B1EBF64F0EBC04CE6D529C8EDB0B6B2184DF5|yvyF]-[gene|F03144BF8A187C8931938A21433431B8961E8EE7|flgM]-[gene|6F4CD36D4C1EE99EF7A503F44F53AEB8EFFEAB7F|yvyG]-[gene|767ADBEF1B40CB3C74116CEA8CFB2FAF19C1FE7B|flgK]-[gene|82AB04023BCB57967C7501E6AEAC4BB593AA6480|flgL]
    description
    [Pubmed|8045879]
    view in new tab

    Biological materials

    Mutant

  • BKE35410 ([gene|767ADBEF1B40CB3C74116CEA8CFB2FAF19C1FE7B|flgK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTCATTTTCTGAATTCCTT, downstream forward: _UP4_GTTGGAGGAAGGTAGGTAGA
  • BKK35410 ([gene|767ADBEF1B40CB3C74116CEA8CFB2FAF19C1FE7B|flgK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTCATTTTCTGAATTCCTT, downstream forward: _UP4_GTTGGAGGAAGGTAGGTAGA
  • References

  • 8412657,8045879,18957862,21736639