SubtiBank SubtiBank
ywoF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywoF

unknown
locus
BSU_36460
pI
4.79
mw
51.28 kDa
protein length
468 aa Sequence Blast
gene length
1407 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,750,768 3,752,174

    The protein

    [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|764E072E7EDA42314D17ECEA2AD983BA95E5ADF9|ywoF]
    description
    [Pubmed|9353933]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18840696], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh]: repression, in [regulon|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh regulon]
  • regulation

  • repressed during logarithmic growth ([protein|search|AbrB]) [Pubmed|18840696]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A898 (ywoF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/898 NBRP B. subtilis, Japan]
  • BKE36460 ([gene|764E072E7EDA42314D17ECEA2AD983BA95E5ADF9|ywoF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCGATTCCCATTTCG, downstream forward: _UP4_TAATTGCTATAAGCGGCGTT
  • BKK36460 ([gene|764E072E7EDA42314D17ECEA2AD983BA95E5ADF9|ywoF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCGATTCCCATTTCG, downstream forward: _UP4_TAATTGCTATAAGCGGCGTT
  • References

  • 18957862,9353933,18840696,220817675