SubtiBank SubtiBank
yjdH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjdH

unknown
locus
BSU_12050
pI
5.11
mw
15.20 kDa
protein length
131 aa Sequence Blast
gene length
396 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.8|Not yet assigned]
  • Gene

    Coordinates
    1,277,062 1,277,457

    Expression and Regulation

    Operons

    genes
    [gene|7640C8D71D22F9F9BB0A9A314136E22EB9F2DD76|yjdH]
    description
    [Pubmed|12480901]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|12480901,15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|12480901,15699190]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B303 (yjdH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1302 NBRP B. subtilis, Japan]
  • BKE12050 ([gene|7640C8D71D22F9F9BB0A9A314136E22EB9F2DD76|yjdH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGCAACCACTCCTTTAT, downstream forward: _UP4_TAGCACAACATGTTATCAGA
  • BKK12050 ([gene|7640C8D71D22F9F9BB0A9A314136E22EB9F2DD76|yjdH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGCAACCACTCCTTTAT, downstream forward: _UP4_TAGCACAACATGTTATCAGA
  • References

  • 12480901,15699190