SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


15.20 kDa
protein length
131 aa Sequence Blast
gene length
396 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Spore coat proteins] → [category|SW|Not yet assigned]
  • Gene

    1,277,062 1,277,457

    Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|12480901,15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|12480901,15699190]
  • view in new tab

    Biological materials


  • MGNA-B303 (yjdH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE12050 ([gene|7640C8D71D22F9F9BB0A9A314136E22EB9F2DD76|yjdH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGCAACCACTCCTTTAT, downstream forward: _UP4_TAGCACAACATGTTATCAGA
  • BKK12050 ([gene|7640C8D71D22F9F9BB0A9A314136E22EB9F2DD76|yjdH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGCAACCACTCCTTTAT, downstream forward: _UP4_TAGCACAACATGTTATCAGA
  • References

  • 12480901,15699190