SubtiBank SubtiBank
hemE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

hemE

uroporphyrinogen decarboxylase (uroporphyrinogen III)
locus
BSU_10120
pI
5.26
mw
39.49 kDa
protein length
353 aa Sequence Blast
gene length
1062 bp Sequence Blast
function
heme biosynthesis
product
uroporphyrinogen decarboxylase (uroporphyrinogen III)
essential
no
ec
4.1.1.37
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.6|Biosynthesis of heme/ siroheme]
  • Gene

    Coordinates
    1,086,117 1,087,178

    The protein

    Catalyzed reaction/ biological activity

  • 4 H+ + uroporphyrinogen III --> 4 CO2 + coproporphyrinogen III (according to UniProt)
  • Protein family

  • uroporphyrinogen decarboxylase family (single member, according to UniProt)
  • Structure

  • [PDB|2INF]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|762E7731EFEAC9F38074D7A7E9A3E5759437CDCA|hemE]-[gene|E4C588EC93132CCBE4F40559F8A480A66A2D82D7|hemH]-[gene|7541AD7D06BC4CE30AD576562E0053CC1E25B4D6|hemY]
    description
    [Pubmed|1459957]
    view in new tab

    Biological materials

    Mutant

  • BKE10120 ([gene|762E7731EFEAC9F38074D7A7E9A3E5759437CDCA|hemE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGATTTCCACCTTTCA, downstream forward: _UP4_TAAGCATATCTTTTGGTATC
  • BKK10120 ([gene|762E7731EFEAC9F38074D7A7E9A3E5759437CDCA|hemE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGATTTCCACCTTTCA, downstream forward: _UP4_TAAGCATATCTTTTGGTATC
  • References

    Reviews

  • 28123057
  • Original Publications

  • 17122346