SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


methylmalonate-semialdehyde dehydrogenase (acylating)
53.29 kDa
protein length
487 aa Sequence Blast
gene length
1464 bp Sequence Blast
myo-inositol catabolism
methylmalonate-semialdehyde dehydrogenase (acylating)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of inositol]
  • Gene

    4,082,920 4,084,383

    The protein

    Catalyzed reaction/ biological activity

  • NAD-dependent oxidation of methylmalonate semialdehyde (MMSA) to propionyl-CoA via acylation and deacylation steps
  • 3-oxopropanoate + CoA + NAD+ --> acetyl-CoA + CO2 + NADH (according to UniProt)
  • 2-methyl-3-oxopropanoate + CoA + H2O + NAD+ --> H+ + hydrogencarbonate + NADH + propanoyl-CoA (according to UniProt)
  • Protein family

  • [SW|aldehyde dehydrogenase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|99F1FAF28FB4817D94E84BD5288FA33124558933|YwdH], [protein|A0BEB92D54799956A4ADE106A1388E5710141069|GabD], [protein|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|YfmT], [protein|F3341F205CB939498109D2A54DE842065C488DD5|AldX], [protein|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|AldY], [protein|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|GbsA], [protein|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|PutC], [protein|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|YcbD], [protein|67A72A0EABCD807C25D8EAC61C251142B45C174E|DhaS], [protein|69838717DC6BB27864D88C282BF5BC7CC558BFD7|RocA]
  • [SW|Cofactors]

  • Coenzyme A, NAD [Pubmed|22782904]
  • Structure

  • [PDB|1T90] [Pubmed|22782904]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9226270], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR]: repression, [Pubmed|9887260,9226270], in [regulon|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by inositol ([protein|search|IolR]) [Pubmed|9887260,9226270]
  • view in new tab

    Biological materials


  • MGNA-B770 (iolA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE39760 ([gene|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTTATTGCCTCCTTCA, downstream forward: _UP4_TAAACGACGAACAGCCGAAC
  • BKK39760 ([gene|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTTATTGCCTCCTTCA, downstream forward: _UP4_TAAACGACGAACAGCCGAAC
  • labs

  • [SW|Yasutaro Fujita], University of Fukuyama, Japan
  • [[Ken-ichi Yoshida]], Kobe University, Japan
  • References

  • 9226270,11566986,10666464,18310071,9887260,9887260,18310071,16332250,22900538