SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


3-deoxy-D-arabino-heptulosonate 7-phosphate synthase / chorismate mutase-isozyme 3
39.38 kDa
protein length
358 aa Sequence Blast
gene length
1077 bp Sequence Blast
biosynthesis of aromatic amino acids
3-deoxy-D-arabino-heptulosonate 7-phosphate synthase /

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of aromatic amino acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    3,045,445 3,046,521

    The protein

    Catalyzed reaction/ biological activity

  • D-erythrose 4-phosphate + H2O + phosphoenolpyruvate --> 7-phospho-2-dehydro-3-deoxy-D-arabino-heptonate + phosphate (according to UniProt)
  • chorismate --> prephenate (according to UniProt)
  • Protein family

  • class-I DAHP synthase family (single member, according to UniProt)
  • Modification

  • phosphorylation on Ser-2 [Pubmed|17218307]
  • phosphorylation on Thr-4 [Pubmed|17726680]
  • phosphorylated on Arg-45 and Arg-301 [Pubmed|22517742]
  • Cys126 is S-bacillithiolated by NaOCl stress in B. subtilis and other Bacillus species [Pubmed|22938038]
  • Effectors of protein activity

  • subject to feedback inhibition [Pubmed|19258532]
  • Structure

  • [PDB|1VR6] (from ''Thermotoga maritima'', 51% identity, 68% similarity)
  • [PDB|5GO2] (chorismate mutase-like domain, with citrate) [pubmed|28743924]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE29750 ([gene|75E331ABCDE1C60AAB4AC01229CED81B0AF50E1C|aroA]::erm trpC2) available at [ BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTTCATCCTTTCCC, downstream forward: _UP4_TAATTGAACAATCCAAAAGG
  • BKK29750 ([gene|75E331ABCDE1C60AAB4AC01229CED81B0AF50E1C|aroA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTTCATCCTTTCCC, downstream forward: _UP4_TAATTGAACAATCCAAAAGG
  • References

  • 22938038,9387221,19258532,17726680,17218307,22517742,15378759,28743924