SubtiBank SubtiBank
opuCA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

opuCA

glycine betaine/carnitine/choline/arsenobetaine/arsenocholine [SW|ABC transporter] (ATP-binding protein)
locus
BSU_33830
pI
6.55
mw
43.09 kDa
protein length
380 aa Sequence Blast
gene length
1143 bp Sequence Blast
function
compatible solute transport
product
glycine betaine/carnitine/choline/arsenobetaine/arsenocholine [SW|ABC transporter] (ATP-binding protein)
essential
no
synonyms
yvbE

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.4|Uptake of compatible solutes for osmoprotection]
  • [category|SW 3|Information processing] → [category|SW 3.5|Targets of second messengers] → [category|SW 3.5.1|Targets of c-di-AMP]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,469,860 3,471,002

    The protein

    Catalyzed reaction/ biological activity

  • uptake of glycine betaine, arsenocholine and arsenobetaine [pubmed|29159878]
  • Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|FB2220730013A98D7C979062A4A451518B92DF09|OpuAA], [protein|3F502A4DCB1DAD7C3F968465B13C35213240515B|OpuBA]
  • [SW|Domains]

  • 2 [SW|CBS domain]s (255-314, 315-373)
  • Effectors of protein activity

  • binds c-di-AMP, which likely inhibits uptake activity [pubmed|31061098]
  • Structure

  • [PDB|2IT1] (from Pyrococcus horikoshii, 35% identity)
  • [PDB|5KS7] ([SW|CBS domain]s from L. monocytogenes, with c-di-AMP bound) [pubmed|27378384]
  • [SW|Localization]

  • associated to the membrane (via [protein|83C45215AC86FACB08CF36EB5F9E6B076D7D0F0F|OpuCB]-[protein|76C8D6BF2CA1FA5E7392C52FFD55FD01EF5AB9DC|OpuCD]) [Pubmed|10092453,18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|75DB6231129C28C5D3791BA43A1261CD46A861E8|opuCA]-[gene|83C45215AC86FACB08CF36EB5F9E6B076D7D0F0F|opuCB]-[gene|CBA6108A10AD8B932BC5B19A0E7982D0F56F1E08|opuCC]-[gene|76C8D6BF2CA1FA5E7392C52FFD55FD01EF5AB9DC|opuCD]
    description
    [Pubmed|10216873]

    regulatory mechanism

  • [protein|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|OpcR]: repression, [Pubmed|23960087], in [regulon|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|OpcR regulon]
  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • induced by salt stress [Pubmed|23960087,10216873]
  • induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials

    Mutant

  • BKE33830 ([gene|75DB6231129C28C5D3791BA43A1261CD46A861E8|opuCA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCCGTGCACCTCCGCAG, downstream forward: _UP4_TGACCAGGGGAGGAGCTCTT
  • BKK33830 ([gene|75DB6231129C28C5D3791BA43A1261CD46A861E8|opuCA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCCGTGCACCTCCGCAG, downstream forward: _UP4_TGACCAGGGGAGGAGCTCTT
  • Expression vectors

  • pGP2939 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • References

    Reviews

  • 27935846
  • Original publications

  • 10092453,9925583,10216873,18763711,21296969,23960087,23646920,27378384,29159878,31061098