SubtiBank SubtiBank
zagA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

zagA

zinc metallochaperone, ZTP activated GTPase A
locus
BSU_03360
pI
4.40
mw
45.15 kDa
protein length
397 aa Sequence Blast
gene length
1194 bp Sequence Blast
function
supply of zinc from [protein|035154A4160F084BA1CC124D0951937B203E167D|RpmE] to [protein|7732A37D59E2643F232F2C0AFE51BCF7A79EDE29|FolE]
product
ZTP activated GTPase A
essential
no
synonyms
yciC

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW 1.3.2.3|Zinc]
  • [category|SW 3|Information processing] → [category|SW 3.5|Targets of second messengers] → [category|SW 3.5.4|Targets of ZTP]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    366,063 367,256

    The protein

    Catalyzed reaction/ biological activity

  • has GTPase and ZTPase activity [pubmed|31132310]
  • mobilization of zinc from [protein|035154A4160F084BA1CC124D0951937B203E167D|RpmE] (after insertion of [protein|DAE7AB27A4C42BF50556BB76F33BEFA8DF35EA3A|RpmEB] into the [SW|ribosome]), to provide it to [protein|7732A37D59E2643F232F2C0AFE51BCF7A79EDE29|FolE] [pubmed|31132310]
  • the interaction with FolE facilitates the supply of zinc to [protein|7732A37D59E2643F232F2C0AFE51BCF7A79EDE29|FolE] under conditions of zinc limitation [pubmed|31132310]
  • Protein family

  • SIMIBI class G3E GTPase family (single member, according to UniProt)
  • Kinetic information

  • KM for GTP: 40 µM [pubmed|31132310]
  • KM for ZTP: 36 µM [pubmed|31132310]
  • Modification

  • phosphorylated on Arg-58 [Pubmed|22517742]
  • Effectors of protein activity

  • ZTP (stimulates interaction with [protein|7732A37D59E2643F232F2C0AFE51BCF7A79EDE29|FolE]) [https://www.biorxiv.org/content/biorxiv/early/2019/03/31/594382.full.pdf reference]
  • Structure

  • [PDB|1NIJ] (YjiA from E. coli, 27% identity) [pubmed|14696199]
  • [SW|Localization]

  • membrane associated [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|F735802BB483C2C5437240AB2E9FC340EAA5B353|yczL]-[gene|75DB07A2704FEC2932BD0CDD24E2B3454E9551E1|zagA]
    description
    [Pubmed|25649915]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12426338], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur]: repression, in the presence of zinc [Pubmed|12426338], in [regulon|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur regulon]
  • view in new tab

    genes
    [gene|93380E8EEB672C14C9BE2B5A6D8573FBCA149514|folEB]-[gene|456AF184261976FAA73359E81443F7035F457D07|yciB]-[gene|F735802BB483C2C5437240AB2E9FC340EAA5B353|yczL]-[gene|75DB07A2704FEC2932BD0CDD24E2B3454E9551E1|zagA]
    description
    [Pubmed|9811636]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12426338], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur]: repression, in the presence of zinc [Pubmed|12426338], in [regulon|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur regulon]
  • regulation

  • [SW|folE2]: induced by zinc starvation ([protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur]) [Pubmed|12426338]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B999 (yciC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1998 NBRP B. subtilis, Japan]
  • BKE03360 ([gene|75DB07A2704FEC2932BD0CDD24E2B3454E9551E1|zagA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATAGTGCCTCCATTAA, downstream forward: _UP4_TAGAAAAAAAGCCGTCCCAT
  • BKK03360 ([gene|75DB07A2704FEC2932BD0CDD24E2B3454E9551E1|zagA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATAGTGCCTCCATTAA, downstream forward: _UP4_TAGAAAAAAAGCCGTCCCAT
  • labs

  • [SW|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
  • References

    Reviews

  • 31220391
  • Original publications

  • 12426338,9811636,18344368,22517742,18763711,23406412,27561249,14696199,31132310