SubtiBank SubtiBank
levD
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

levD

fructose-specific phosphotransferase system, EIIA component of the PTS
locus
BSU27070
pI
4.48
mw
16.11 kDa
protein length
146 aa Sequence Blast
gene length
438 bp Sequence Blast
function
fructose uptake and phosphorylation
product
fructose-specific phosphotransferase system, EIIA component
essential
no
ec
2.7.1.69
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW 1.2.2.2|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.27|Utilization of other polymeric carbohydrates]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.7|Utilization of fructose]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    2,762,395 → 2,762,835

    The protein

    Catalyzed reaction/ biological activity

  • Protein EIIA N(pi)-phospho-L-histidine + protein EIIB = protein EIIA + protein EIIB N(pi)-phospho-L-histidine (according to Swiss-Prot)
  • Protein family

  • [protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|PtsI] permease, mannose permease (Man) family [Pubmed|10627040]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|75C568C8F6912AC064B8B435975D52510D25466A|levD]-[gene|CAE38D8F25A5EC6AC8045E40072E6FEC632045FA|levE]-[gene|8ABA3735067C7AA433E09F219EE7239196377A95|levF]-[gene|F23B951F60A6A669D5BD86836906E0F4AD7A0C1B|levG]-[gene|61D5B957E018D019AE0CE1D5F6C6A33EF982ED49|sacC]
    description
    [Pubmed|2117666]

    sigma factors

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]: sigma factor, [Pubmed|1924373], in [regulon|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|7592486], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|1D2043CC0D8CF64142F0A5993A936C5A196726D4|LevR]: activation, [Pubmed|1900939], in [regulon|1D2043CC0D8CF64142F0A5993A936C5A196726D4|LevR regulon]
  • regulation

  • induced in the presence of fructose ([protein|search|LevR]) [Pubmed|1900939]
  • view in new tab

    Biological materials

    Mutant

  • BKE27070 (Δ[gene|75C568C8F6912AC064B8B435975D52510D25466A|levD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTATTGCTCCTTTCC, downstream forward: _UP4_GATACAAGAGAGGATGAATT
  • BKK27070 (Δ[gene|75C568C8F6912AC064B8B435975D52510D25466A|levD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTATTGCTCCTTTCC, downstream forward: _UP4_GATACAAGAGAGGATGAATT
  • References

  • 10627040,2117666,1619665,7592487,7592486,9033408,1924373,7592486,1900939,22900538