SubtiBank SubtiBank
htrC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

htrC

similar to quality control membrane serine protease [protein|76FA52D5A5F9FCA14BA9B45872FE3D99D89B211B|HtrA]
locus
BSU_40360
pI
5.32
mw
42.63 kDa
protein length
400 aa Sequence Blast
gene length
1203 bp Sequence Blast
function
unknown
product
putative quality control membrane protease
essential
no
synonyms
yycK,yyxA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.1|Protein quality control]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    4,147,567 4,148,769

    The protein

    Protein family

  • Peptidase S1C family (with [protein|76FA52D5A5F9FCA14BA9B45872FE3D99D89B211B|HtrA] and [protein|796216BE9CD6DADFEADC29497253C81BF496A2ED|HtrB], according to UniProt)
  • Paralogous protein(s)

  • [protein|76FA52D5A5F9FCA14BA9B45872FE3D99D89B211B|HtrA]
  • [SW|Domains]

  • transmembrane helix (aa 22 - 42) (according to UniProt)
  • [SW|PDZ domain] (aa 295 - 392) (according to UniProt)
  • Structure

  • [PDB|3QO6] (from Arabidopsis thaliana, 37% identity) [pubmed|21532594]
  • [SW|Localization]

  • inner spore membrane [Pubmed|26731423]
  • Expression and Regulation

    Operons

    genes
    [gene|75B8C37E589C855D2BAD7FB51B9600E161ACFBD3|htrC]
    description
    [Pubmed|9829949]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|9829949], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • ''htrC'' transcript expressed during sporulation [Pubmed|9829949]
  • view in new tab

    genes
    [gene|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|walR]-[gene|E88978809272FAC2520DB4ABCA0554F8028F3451|walK]-[gene|06D2D03C65D50E3909B2C93835193815B6016967|walH]-[gene|EE681C9A42FCC29CBB55CC9566EE4CFF986D0F1D|walI]-[gene|D5321F707E183E72B225F1CED2F2FDCB1183B88A|walJ]-[gene|75B8C37E589C855D2BAD7FB51B9600E161ACFBD3|htrC]
    description
    [Pubmed|9829949]

    regulation

  • ''htrC'' transcript expressed during sporulation [Pubmed|9829949]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B823 (yycK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1822 NBRP B. subtilis, Japan]
  • BKE40360 ([gene|75B8C37E589C855D2BAD7FB51B9600E161ACFBD3|htrC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCCATCCTTTCCAAG, downstream forward: _UP4_TAATAAAAGCAGTCTGGCAT
  • BKK40360 ([gene|75B8C37E589C855D2BAD7FB51B9600E161ACFBD3|htrC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCCATCCTTTCCAAG, downstream forward: _UP4_TAATAAAAGCAGTCTGGCAT
  • References

    Reviews

  • 21326199
  • Original publications

  • 17600057,12270824,11555295,18957862,10692364,21624103,22307758,22092710,24362423,9829949,21630458,24115457,25384476,26731423,21532594