SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


galactotriose [SW|ABC transporter] (permease)
46.82 kDa
protein length
418 aa Sequence Blast
gene length
1257 bp Sequence Blast
uptake of galactotriose
galactotriose [SW|ABC transporter] (permease)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of galactan]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,505,957 3,507,213

    Phenotypes of a mutant

  • a ''[gene|D4A5A878F87EBC14C02824233155CEBACEB41343|ganS]-[gene|75B1FD4AA7612B3B600CB0CE35319A6960536095|ganP]-[gene|676932E7DF143DC9AAAF1F415FB3D14EE25B2C2F|ganQ]-[gene|DBBA549C2D71CF628E92AC7B659EA276E227D742|ganA]-[gene|9DDEF5682B2D145830F33C7A1D5A6EC8527BB405|ganB]'' mutant is impaired in the utilization of galactan [Pubmed|22893383]
  • The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|EA2DD9892C1128ADCD6C8BC61248EBE45339E6D6|MdxF]
  • [SW|Domains]

  • [SW|ABC transmembrane type-1 domain] (aa 187-407) (according to UniProt)
  • Structure

  • [PDB|2R6G] (from E. coli, C-terminal domain, aa 165-412, 41% identity) [pubmed|18033289]
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|27501980], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1F787F70C87DEB221709579122D63C2322A84E56|GanR]: repression, [Pubmed|9287030], in [regulon|1F787F70C87DEB221709579122D63C2322A84E56|GanR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [pubmed|28617843], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by galactan (binding of galactobiose to [protein|1F787F70C87DEB221709579122D63C2322A84E56|GanR]) [Pubmed|28617843,27501980]
  • repressed by glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|28617843,27501980]
  • view in new tab

    Biological materials


  • MGNA-A485 (yvfL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34150 ([gene|75B1FD4AA7612B3B600CB0CE35319A6960536095|ganP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCGTTTTCACCTCTCTTA, downstream forward: _UP4_TCTTTTAAAGAGGAGGCATA
  • BKK34150 ([gene|75B1FD4AA7612B3B600CB0CE35319A6960536095|ganP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCGTTTTCACCTCTCTTA, downstream forward: _UP4_TCTTTTAAAGAGGAGGCATA
  • References

  • 10092453,9287030,22893383,27501980,18033289