SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


branched-chain amino acid transporter
46.45 kDa
protein length
445 aa Sequence Blast
gene length
1338 bp Sequence Blast
uptake of branched-chain amino acids
branched-chain amino acid transporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Amino acid transporters] → [category|SW|Other amino acid transporters]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of branched-chain amino acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,028,297 3,029,634

    Phenotypes of a mutant

  • no phenotype for the single mutant, the triple ''[gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP] [gene|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|brnQ] [gene|75A874F0C344E8404BE39C32EFF59CE562193640|braB]'' mutant is strongly impaired in the transport of isoleucine and valine at low concentrations [Pubmed|25645558]
  • The protein

    Catalyzed reaction/ biological activity

  • high affinity uptake of isoleucine and valine [Pubmed|25645558]
  • Protein family

  • branched chain amino acid transporter family (together with [protein|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|BrnQ]) (according to UniProt)
  • Paralogous protein(s)

  • [protein|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|BrnQ]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|26473603], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|26473603], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|26473603], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • regulation

  • induced in the absence of branched-chain amino acids ([SW|CodY], [SW|ScoC]) [Pubmed|26473603]
  • additional information

  • note that [SW|CodY] represses the expression of ''[protein|search|scoC]'', therefore ''[protein|search|braB]'' expression is increased at intermediate levels of [SW|CodY] activity [Pubmed|26473603]
  • view in new tab

    Biological materials


  • BKE29600 ([gene|75A874F0C344E8404BE39C32EFF59CE562193640|braB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAAAAAATCCTCCTAA, downstream forward: _UP4_TAATGTCACAGAACGCCTGC
  • BKK29600 ([gene|75A874F0C344E8404BE39C32EFF59CE562193640|braB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAAAAAATCCTCCTAA, downstream forward: _UP4_TAATGTCACAGAACGCCTGC
  • References

  • 9387221,25645558,26473603