SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


potassium channel protein (exporter)
37.00 kDa
protein length
328 aa Sequence Blast
gene length
987 bp Sequence Blast
potassium exporter
potassium channel protein

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW|Potassium uptake/ export]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Regulation]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,218,854 3,219,840

    Phenotypes of a mutant

  • reduced [SW|biofilm formation] (can be suppressed by inactivation of ''[gene|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]'') [Pubmed|23737939]
  • The protein


  • contains a [SW|RCK_N domain] (aa 116-245) (according to [ UniProt])
  • Structure

  • [PDB|3RBZ] (from Methanothermobacter thermautotrophicus, 24% identity)
  • [SW|Localization]

  • inner spore membrane [Pubmed|26731423]
  • Additional information

  • potassium exporter activity of YugO is activated by glutamate limitation via the C-terminal domain [Pubmed|26503040]
  • Expression and Regulation



    regulatory mechanism

  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|23737939], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • regulation

  • repressed by [protein|search|SinR] [Pubmed|23737939]
  • additional information

  • potassium exporter activity of YugO is activated by glutamate limitation via the C-terminal domain [Pubmed|26503040]
  • view in new tab

    Biological materials


  • MGNA-A624 (yugO::erm), available at the [ NBRP B. subtilis, Japan]
  • GP2098 (''yugO''::''ermC''), available in [SW|Jörg Stülke]'s lab [pubmed|28679749]
  • GP2296 (''yugO''::''tet''), available in [SW|Jörg Stülke]'s lab
  • BKE31322 ([gene|752860E73AD1A72D6598F995B80F5B21A77A5CBD|yugO]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGAAATAAATATCCGATTTG, downstream forward: _UP4_GAAACAGATCAATTCCTTGC
  • BKK31322 ([gene|752860E73AD1A72D6598F995B80F5B21A77A5CBD|yugO]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGAAATAAATATCCGATTTG, downstream forward: _UP4_GAAACAGATCAATTCCTTGC
  • FLAG-tag construct

  • GP2442 ''yugO-3xFLAG spc'' (based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • References


  • 26503058,27935846,28086088,28622518,31361596
  • Original publications

  • 23737939,26503040,26731423,10617203,28086091,28386026