SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


11.03 kDa
protein length
gene length
294 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    2,029,020 2,029,313

    Expression and Regulation



    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325]
  • view in new tab

    additional information

  • the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
  • Biological materials


  • BKE18600 ([gene|74E4889419A396A6976D752CE5914A9A5ADCCCA4|yozQ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTACTTCCTCCAGATT, downstream forward: _UP4_TAGCCATACAAACGGAACTA
  • BKK18600 ([gene|74E4889419A396A6976D752CE5914A9A5ADCCCA4|yozQ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTACTTCCTCCAGATT, downstream forward: _UP4_TAGCCATACAAACGGAACTA
  • References

  • 16497325,30782632