SubtiBank SubtiBank
hlpB
The papers of the month are back! Check them out! Link here

hlpB

HNH nuclease-like protein, rescues AddA-AddB-mediated recombination intermediates
locus
BSU10660
pI
9.94
mw
11.31 kDa
protein length
100 aa Sequence Blast
gene length
300 bp Sequence Blast
function
rescuing of AddA-AddB-mediated recombination intermediates
product
HNH nuclease-like protein
essential
no
synonyms
yisB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • Gene

    Coordinates
    1,148,155 → 1,148,457

    Phenotypes of a mutant

  • essential, the mutation can be suppressed by second-site mutations in ''[gene|49E8BFEC1CAB77DD91E0ED0791EBD480E4871239|addA]'' or ''[gene|55A1EF8A10CB398CCD3FDD06D9483FE0DCE31C64|addB]'' [Pubmed|22984257], non-essential according to [Pubmed|28189581]
  • The protein

    [SW|Localization]

  • evenly distributed throughout the cytosol in growing cells [Pubmed|22984257]
  • forms a single focus on the nucleoid upon induction of DNA damage [Pubmed|22984257]
  • Expression and Regulation

    Operons

    genes
    [gene|55A1EF8A10CB398CCD3FDD06D9483FE0DCE31C64|addB]-[gene|49E8BFEC1CAB77DD91E0ED0791EBD480E4871239|addA]-[gene|4D89BFFB1073407A7A1762AFD18B49F3414D6787|sbcD]-[gene|ED825D5B3290BA8F9C92477B1FCC433ADB3C8449|sbcC]-[gene|74E2AB77354355549D14152D3566C9B953A4CB31|hlpB]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7746142], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • regulation

  • positive control by [protein|search|ComK] [Pubmed|7746142]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A503 (yisB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/503 NBRP B. subtilis, Japan]
  • BKE10660 (Δ[gene|74E2AB77354355549D14152D3566C9B953A4CB31|hlpB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGCTTTGCCATATCCGCTC, downstream forward: _UP4_TGACTAAAAAGCAGCCCTCT
  • BKK10660 (Δ[gene|74E2AB77354355549D14152D3566C9B953A4CB31|hlpB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGCTTTGCCATATCCGCTC, downstream forward: _UP4_TGACTAAAAAGCAGCCCTCT
  • References

  • 11948146,22984257,22383849,28189581