SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


phosphoenolpyruvate carboxykinase
58.13 kDa
protein length
527 aa Sequence Blast
gene length
1584 bp Sequence Blast
synthesis of phosphoenolpyruvate
phosphoenolpyruvate carboxykinase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|Gluconeogenesis]
  • Gene

    3,129,530 3,131,113

    The protein

    Catalyzed reaction/ biological activity

  • ATP + oxaloacetate --> ADP + CO2 + phosphoenolpyruvate (according to UniProt)
  • Protein family

  • phosphoenolpyruvate carboxykinase (ATP) family (single member, according to UniProt)
  • [SW|Domains]

  • Nucleotide binding Domain (233240)
  • Structure

  • [PDB|2PXZ] (''E.coli'')
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot), cytoplasm
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15720552], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|CcpN]: repression, [Pubmed|15720552], in [regulon|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|CcpN regulon]
  • regulation

  • repressed by glucose (35-fold) [protein|search|CcpN] [Pubmed|15720552,12850135]
  • view in new tab

    Biological materials


  • 1A1005 ( ''pckA''::''spec''), [Pubmed| ], available at [ BGSC]
  • 1A996 ( ''pckA''::''spec''), [Pubmed| ], available at [ BGSC]
  • GP1147 (''pckA''::''neo''), available in [SW|Jörg Stülke]'s lab
  • BKE30560 ([gene|74D4616D1A550D87182FAAC2A4AF6E04F81E1572|pckA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGAAACCTTCCTTTAT, downstream forward: _UP4_TAAAAAACAAAAGCCAAGAG
  • BKK30560 ([gene|74D4616D1A550D87182FAAC2A4AF6E04F81E1572|pckA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGAAACCTTCCTTTAT, downstream forward: _UP4_TAAAAAACAAAAGCCAAGAG
  • Expression vectors

  • pGP1753 (N-terminal Strep-tag, for [SW|SPINE], purification from ''B. subtilis'', in [SW|pGP380]) (available in [SW|Jörg Stülke]'s lab) [pubmed|20933603]
  • pGP1762 (for expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844], available in [SW|Jörg Stülke]'s lab)
  • pGP1763 (for expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172], available in [SW|Jörg Stülke]'s lab)
  • GFP fusion

  • GP1430 (spc, based on [SW|pGP1870]), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1129 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab [pubmed|20933603]
  • labs

  • [SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
  • References

  • 12850135,15720552,18586936,9387221,20933603,22190493,23136871