SubtiBank SubtiBank
yqcK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqcK

similar to C-As lyase
locus
BSU25800
pI
5.05
mw
16.49 kDa
protein length
146 aa Sequence Blast
gene length
441 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,656,816 2,657,256

    The protein

    Structure

  • [PDB|5D4F] (from Thermomonospora curvata, 37% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|B3D88B9C89154B77D77FB833CA16FD4F4E29FE96|arsR]-[gene|74B1AF103E6B236609CD184A1A409A9A04857181|yqcK]-[gene|B749D54249A28A471EF796903A34622A16D5B0BB|arsB]-[gene|DB3527FB78D0B7C144D1699D665788184F19AFE0|arsC]
    description
    [Pubmed|9537360]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9537360], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|B3D88B9C89154B77D77FB833CA16FD4F4E29FE96|ArsR]: repression, [Pubmed|9537360], in [regulon|B3D88B9C89154B77D77FB833CA16FD4F4E29FE96|ArsR regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|16497325]
  • view in new tab

    Biological materials

    Mutant

  • BKE25800 ([gene|74B1AF103E6B236609CD184A1A409A9A04857181|yqcK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTAATTCCCCCTCTTA, downstream forward: _UP4_TAGTAAAAAAGGTGAGGATA
  • BKK25800 ([gene|74B1AF103E6B236609CD184A1A409A9A04857181|yqcK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTAATTCCCCCTCTTA, downstream forward: _UP4_TAGTAAAAAAGGTGAGGATA
  • References

  • 9537360,16497325