SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to [SW|ABC transporter] (membrane protein)
29.31 kDa
protein length
253 aa Sequence Blast
gene length
762 bp Sequence Blast
[SW|ABC transporter] (membrane protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Exporters] → [category|SW|Exporters of unknown function]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    980,473 981,234

    The protein


  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A658 (yhcE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE09050 ([gene|74B0D594308D313A54C7163759628655382B1F94|yhcE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAAACCTAAAAAAGAATTCA, downstream forward: _UP4_GATCGTAAAGTAGAGGTGTA
  • BKK09050 ([gene|74B0D594308D313A54C7163759628655382B1F94|yhcE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAAACCTAAAAAAGAATTCA, downstream forward: _UP4_GATCGTAAAGTAGAGGTGTA
  • References

  • 10092453,21815947