SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


multidrug efflux transporter
12.19 kDa
protein length
117 aa Sequence Blast
gene length
354 bp Sequence Blast
multidrug resistance
multidrug efflux transporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Multidrug exporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,864,691 1,865,044

    The protein

    Protein family

  • paired small multidrug resistance protein family ([SW|PSMR family]) [Pubmed|17942072]
  • [SW|drug/metabolite transporter (DMT) superfamily] (according to UniProt)
  • [SW|Small multidrug resistance (SMR) (TC 2.A.7.1) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|53576746FF1B644A1980F8ACD0E8F4A54CDDAD83|EbrA]
  • Structure

  • [PDB|3B5D] (EmrE from E. coli, 39% identity) [pubmed|18024586]
  • [SW|Localization]

  • cell membrane [Pubmed|17417881]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B077 (ebrB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE17290 ([gene|74668FF19D097722D523CC54288B6409DE267631|ebrB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCCTCTCATCTTCATCA, downstream forward: _UP4_GCCTGTGAGTGACCGTCTGT
  • BKK17290 ([gene|74668FF19D097722D523CC54288B6409DE267631|ebrB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCCTCTCATCTTCATCA, downstream forward: _UP4_GCCTGTGAGTGACCGTCTGT
  • References


  • 17942072
  • Original publications

  • 17417881,18024586