SubtiBank SubtiBank
ebrB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ebrB

multidrug efflux transporter
locus
BSU_17290
pI
6.93
mw
12.19 kDa
protein length
117 aa Sequence Blast
gene length
354 bp Sequence Blast
function
multidrug resistance
product
multidrug efflux transporter
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.14|Multidrug exporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,864,691 1,865,044

    The protein

    Protein family

  • paired small multidrug resistance protein family ([SW|PSMR family]) [Pubmed|17942072]
  • [SW|drug/metabolite transporter (DMT) superfamily] (according to UniProt)
  • [SW|Small multidrug resistance (SMR) (TC 2.A.7.1) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|53576746FF1B644A1980F8ACD0E8F4A54CDDAD83|EbrA]
  • Structure

  • [PDB|3B5D] (EmrE from E. coli, 39% identity) [pubmed|18024586]
  • [SW|Localization]

  • cell membrane [Pubmed|17417881]
  • Expression and Regulation

    Operons

    genes
    [gene|53576746FF1B644A1980F8ACD0E8F4A54CDDAD83|ebrA]-[gene|74668FF19D097722D523CC54288B6409DE267631|ebrB]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B077 (ebrB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1076 NBRP B. subtilis, Japan]
  • BKE17290 ([gene|74668FF19D097722D523CC54288B6409DE267631|ebrB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCCTCTCATCTTCATCA, downstream forward: _UP4_GCCTGTGAGTGACCGTCTGT
  • BKK17290 ([gene|74668FF19D097722D523CC54288B6409DE267631|ebrB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCCTCTCATCTTCATCA, downstream forward: _UP4_GCCTGTGAGTGACCGTCTGT
  • References

    Reviews

  • 17942072
  • Original publications

  • 17417881,18024586