SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to prolyl aminopeptidase
30.55 kDa
protein length
274 aa Sequence Blast
gene length
825 bp Sequence Blast
ubiquinone and menaquinone biosynthesis

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of menaquinone/ based on similarity]
  • Gene

    3,149,751 3,150,575

    The protein

    Catalyzed reaction/ biological activity

  • 5-enolpyruvoyl-6-hydroxy-2-succinyl-cyclohex-3-ene-1-carboxylate --> (1R,6R)-6-hydroxy-2-succinyl-cyclohexa-2,4-diene-1-carboxylate + pyruvate (according to UniProt)
  • Protein family

  • [SW|AB hydrolase superfamily] (according to UniProt)
  • [SW|Domains]

  • [SW|AB hydrolase-1 domain] (aa 26-259) (according to UniProt)
  • Structure

  • [PDB|2XMZ] (from ''Staphylococcus aureus'', 34% identity) [Pubmed|21513522]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8550504], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|mntA]' and '[protein|search|menC]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • MGNA-A283 (ytxM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE30810 ([gene|74659B6794496912E139B3CF9EFF787B63729A3F|ytxM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACACCATCTGATACCGTTA, downstream forward: _UP4_TGACTCATTCACATAGAGAA
  • BKK30810 ([gene|74659B6794496912E139B3CF9EFF787B63729A3F|ytxM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACACCATCTGATACCGTTA, downstream forward: _UP4_TGACTCATTCACATAGAGAA
  • References

  • 10913081,9387221,1629163,8550504,12454479,21513522