SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


15.77 kDa
protein length
148 aa Sequence Blast
gene length
447 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    567,662 568,108

    Expression and Regulation



    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials


  • MGNA-C131 (ydeH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE05200 ([gene|741F90C14739AAD2946C2DA9B315E9979A9D26E4|ydeH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTAAAGAATATGCAGTG, downstream forward: _UP4_TAATCATCGAATTGTTATTT
  • BKK05200 ([gene|741F90C14739AAD2946C2DA9B315E9979A9D26E4|ydeH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTAAAGAATATGCAGTG, downstream forward: _UP4_TAATCATCGAATTGTTATTT
  • References

  • 20817675