SubtiBank SubtiBank
nifZ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

nifZ

cysteine desulfurase, biosynthesis of 4-thiouridine in tRNA
locus
BSU_29590
pI
6.34
mw
41.33 kDa
protein length
381 aa Sequence Blast
gene length
1146 bp Sequence Blast
function
biosynthesis of 4-thiouridine in tRNA
product
cysteine desulfurase
essential
no
synonyms
iscSB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • Gene

    Coordinates
    3,026,957 3,028,102

    The protein

    Catalyzed reaction/ biological activity

  • removes sulfuryl group from cysteine and transfers it to [protein|A64A59C2B15015F13911EC53763D370F780400FD|ThiI] [Pubmed|22773787]
  • [sulfur carrier]-H + L-cysteine --> [sulfur carrier]-SH + L-alanine (according to UniProt)
  • Protein family

  • [SW|Class-V pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|88ACE6B79534338F7C72F107B35A0B2384007088|SufS], [protein|A6746AE1B92A0CDCCB22B57B6DF78094BB0223A8|NifS], [protein|4F5945C3C8F18BD1B30D97CD516A06077C200B9D|YrvO], [protein|5424A936643C90B3DA2CB60FD0FD42A64F2BAF09|YcbU]
  • [SW|Cofactors]

  • PLP
  • Structure

  • [PDB|1EG5] (NifS-like protein from Thermotoga maritima, 35% identity, 55% similarity) [Pubmed|10715213]
  • Expression and Regulation

    Operons

    genes
    [gene|741DCFFBB8FF6A4E357EE5110EBE24412DE34244|nifZ]-[gene|A64A59C2B15015F13911EC53763D370F780400FD|thiI]-[gene|80B5DAED9B4BD015D877DB4819AB25FC5F165C6D|sspA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE29590 ([gene|741DCFFBB8FF6A4E357EE5110EBE24412DE34244|nifZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTTACTCCTTTAT, downstream forward: _UP4_TTAAGGGAAATGATGAGGTA
  • BKK29590 ([gene|741DCFFBB8FF6A4E357EE5110EBE24412DE34244|nifZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTTACTCCTTTAT, downstream forward: _UP4_TTAAGGGAAATGATGAGGTA
  • References

    Reviews

  • 19348578
  • Original publications

  • 10715213,22773787