The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yomQ

unknown

locus: BSU_21260

pI: 3.99

mw: 13.14 kDa

protein length: 116 aa

gene length: 351 bp

function: unknown

product: unknown

essential: no

synonyms

Genomic Context

categories

• [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
• [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]

Gene

Coordinates: 2,243,642 2,243,992

Expression and Regulation

additional information

• translation is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]

Biological materials

Mutant

• BKE21260 ([gene|74137B4DA75E9AD374356DE0AE05F3E7BFC751FF|yomQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGACTTACCTCCTAATTC, downstream forward: _UP4_GCATGAGCAATTTTTGGGTT
• BKK21260 ([gene|74137B4DA75E9AD374356DE0AE05F3E7BFC751FF|yomQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGACTTACCTCCTAATTC, downstream forward: _UP4_GCATGAGCAATTTTTGGGTT