The second international online conference
#Subtillery2021 will be held 14th - 18th June - save the date, for more information see the
conference website!
The 21st
International Conference on Bacilli has been postponed to 2022 and will take place in Prague.
yomQ
Genomic Context
categories
[category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage][category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]Gene
Coordinates
2,243,642 2,243,992
Expression and Regulation
additional information
translation is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]Biological materials
Mutant
BKE21260 ([gene|74137B4DA75E9AD374356DE0AE05F3E7BFC751FF|yomQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGACTTACCTCCTAATTC, downstream forward: _UP4_GCATGAGCAATTTTTGGGTTBKK21260 ([gene|74137B4DA75E9AD374356DE0AE05F3E7BFC751FF|yomQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGACTTACCTCCTAATTC, downstream forward: _UP4_GCATGAGCAATTTTTGGGTT