SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


13.14 kDa
protein length
116 aa Sequence Blast
gene length
351 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • Gene

    2,243,642 2,243,992

    Expression and Regulation

    additional information

  • translation is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials


  • BKE21260 ([gene|74137B4DA75E9AD374356DE0AE05F3E7BFC751FF|yomQ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGACTTACCTCCTAATTC, downstream forward: _UP4_GCATGAGCAATTTTTGGGTT
  • BKK21260 ([gene|74137B4DA75E9AD374356DE0AE05F3E7BFC751FF|yomQ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGACTTACCTCCTAATTC, downstream forward: _UP4_GCATGAGCAATTTTTGGGTT