SubtiBank SubtiBank
yomQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yomQ

unknown
locus
BSU_21260
pI
3.99
mw
13.14 kDa
protein length
116 aa Sequence Blast
gene length
351 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • Gene

    Coordinates
    2,243,642 2,243,992

    Expression and Regulation

    additional information

  • translation is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials

    Mutant

  • BKE21260 ([gene|74137B4DA75E9AD374356DE0AE05F3E7BFC751FF|yomQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGACTTACCTCCTAATTC, downstream forward: _UP4_GCATGAGCAATTTTTGGGTT
  • BKK21260 ([gene|74137B4DA75E9AD374356DE0AE05F3E7BFC751FF|yomQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGACTTACCTCCTAATTC, downstream forward: _UP4_GCATGAGCAATTTTTGGGTT