SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


tRNA (m7G46) methyltransferase
24.36 kDa
protein length
213 aa Sequence Blast
gene length
642 bp Sequence Blast
tRNA modification
tRNA (m7G46) methyltransferase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|tRNA modification and maturation]
  • Gene

    3,059,547 3,060,188

    The protein

    Catalyzed reaction/ biological activity

  • guanosine46 in tRNA + S-adenosyl-L-methionine --> N7-methylguanosine46 in tRNA + S-adenosyl-L-homocysteine (according to UniProt)
  • Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • [SW|class I-like SAM-binding methyltransferase superfamily] (according to UniProt)
  • [SW|Cofactors]

  • S-adenosylmethionine [pubmed|16600901]
  • Structure

  • [PDB|2FCA] [pubmed|16600901]
  • Expression and Regulation


    view in new tab

    Biological materials


  • GP2649 ([gene|73ED086EED7CECBE2FCADFBC964F1263CF825DB0|trmB]::''cat''), available in [SW|Jörg Stülke]'s lab
  • MGNA-A435 (ytmQ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE29900 ([gene|73ED086EED7CECBE2FCADFBC964F1263CF825DB0|trmB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGATTGACACCTCTAT, downstream forward: _UP4_TAAAGACAGACTCTGACAGG
  • BKK29900 ([gene|73ED086EED7CECBE2FCADFBC964F1263CF825DB0|trmB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGATTGACACCTCTAT, downstream forward: _UP4_TAAAGACAGACTCTGACAGG
  • References

  • 16600901,9387221,27965289