SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


[SW|MarR family|MarR/DUF24 family] transcription repressor of [gene|CFFFFE96FB7AEEF7190F81332369F0A6834C34A4|azoR1], [gene|B7A0D1B3CAA2733A33BCCDDB6774ABF1A0223473|catD]-[gene|search|catE ]and [gene|search|yodC ]expression
12.71 kDa
protein length
112 aa Sequence Blast
gene length
339 bp Sequence Blast
regulation of quinone and diamide detoxification
[SW|MarR family|MarR/DUF24 family] transcription repressor

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    2,127,345 2,127,683

    Phenotypes of a mutant

  • increased resistance to catechol, quinones and diamide [Pubmed|20639328]
  • The protein

    Protein family

  • [SW|MarR family|MarR/DUF24 family]
  • Paralogous protein(s)

  • [protein|91085DA5E71B88E533D2E1D1BFB53E908116C6AA|HypR], [protein|C57DDC9710CB557179B062F9C5D786DB02A3B5FC|YkvN], [protein|D9A187961CFB9496A6712E9E48AAD384357A3E1C|HxlR], [protein|E757C4B329A99E3D0C70C77437DF4DDA300CA5E7|YdzF], [protein|5B9C4932B2E76D6B8F6BDB640D1ADEE28F488FAD|CatR], [protein|51B1913B59C1876CCED4A88414797B3A22BE4E3C|YdeP], [protein|1E74F0557FF9ECB404B6544831F4E0A162473423|YtcD]
  • [SW|Domains]

  • [SW|HTH hxlR-type domain] (aa 6-105) (according to UniProt)
  • Modification

  • redox-controlled by intersubunit disulfide formation of Cys6 and Cys101' in response to quinones and diamide
  • Effectors of protein activity

  • responds distinctly to diamide or methyl-p-benzoquinone [Pubmed|27531959]
  • Structure

  • [PDB|5HS7] (reduced form) [Pubmed|27531959]
  • [PDB|5HS8] (diamide-treated form) [Pubmed|27531959]
  • [PDB|5HS9] (quinone-bound form) [Pubmed|27531959]
  • additional information

  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation



    regulatory mechanism

  • [protein|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|YodB]: repression, in [regulon|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|YodB regulon]
  • view in new tab

    Biological materials


  • MGNA-B433 (yodB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE19540 ([gene|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|yodB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGTCTTCATCCCTTCA, downstream forward: _UP4_TAAGGAAAGCGGCACCTGAA
  • BKK19540 ([gene|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|yodB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGTCTTCATCCCTTCA, downstream forward: _UP4_TAAGGAAAGCGGCACCTGAA
  • labs

  • [SW|Haike Antelmann],University of Greifswald, Germany
  • References


  • 18282125,20626317
  • Original Publications

  • 17158660,17407181,18208493,20639328,20652907,21749987,27531959