SubtiBank SubtiBank
yorA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yorA

unknown
locus
BSU_20450
pI
5.86
mw
64.80 kDa
protein length
586 aa Sequence Blast
gene length
1761 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,188,204 2,189,964

    Biological materials

    Mutant

  • BKE20450 ([gene|7393DA173BEFE0CA2FB4D8E07D3B9D9A926C9697|yorA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE20450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTCATGGTGCTACACCAGC, downstream forward: _UP4_TAAAAAATTCTTAACGAGAA
  • BKK20450 ([gene|7393DA173BEFE0CA2FB4D8E07D3B9D9A926C9697|yorA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK20450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTCATGGTGCTACACCAGC, downstream forward: _UP4_TAAAAAATTCTTAACGAGAA