SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


laccase, bilirubin oxidase, spore coat protein (outer)
58.33 kDa
protein length
513 aa Sequence Blast
gene length
1542 bp Sequence Blast
resistance of the spore
laccase, bilirubin oxidase

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Spore coat proteins] → [category|SW|Class V]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • Gene

    683,462 685,003

    The protein

    Protein family

  • S.antibioticus phenoxazinone synthase (PhsA)
  • Structure

  • [PDB|2BHF] (reduced form)
  • [SW|Localization]

  • outer spore coat, more abundant at the mother cell-distal pole of the forespore, localization depends on [protein|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|CotE] [Pubmed|22171814,19933362]
  • Expression and Regulation



    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,3135411], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, [Pubmed|15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|15383836]
  • additional information

  • [protein|search|translation] is likely to require [protein|search|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • view in new tab

    Biological materials


  • 1S101 ( ''cotA''::''cat''), [Pubmed|2821284], available at [ BGSC]
  • 1S134 ( ''cotA''::''kan''), [Pubmed|11514528], available at [ BGSC]
  • BKE06300 ([gene|73473E6556D374C8623A426E075038AD01AB7025|cotA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCATCTGTCCTTATC, downstream forward: _UP4_TAACCCGACAAACTTGCCTC
  • BKK06300 ([gene|73473E6556D374C8623A426E075038AD01AB7025|cotA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCATCTGTCCTTATC, downstream forward: _UP4_TAACCCGACAAACTTGCCTC
  • References


  • 23202530
  • Original publications

  • 15699190,3135411,11514528,1518043,2821284,19933362,20200715,20551082,20822511,21369750,22281748,23859715,22171814,22410485,15383836,26062535,24293734,24733162,25259857,25847445,26784443,27050268,28870294,29301022