SubtiBank SubtiBank
cotA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cotA

laccase, bilirubin oxidase, spore coat protein (outer)
locus
BSU_06300
pI
5.89
mw
58.33 kDa
protein length
513 aa Sequence Blast
gene length
1542 bp Sequence Blast
function
resistance of the spore
product
laccase, bilirubin oxidase
essential
no
ec
1.3.3.5
synonyms
pig

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.5|Class V]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • Gene

    Coordinates
    683,462 685,003

    The protein

    Protein family

  • S.antibioticus phenoxazinone synthase (PhsA)
  • Structure

  • [PDB|2BHF] (reduced form)
  • [SW|Localization]

  • outer spore coat, more abundant at the mother cell-distal pole of the forespore, localization depends on [protein|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|CotE] [Pubmed|22171814,19933362]
  • Expression and Regulation

    Operons

    genes
    [gene|73473E6556D374C8623A426E075038AD01AB7025|cotA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,3135411], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, [Pubmed|15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|15383836]
  • additional information

  • [protein|search|translation] is likely to require [protein|search|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • view in new tab

    Biological materials

    Mutant

  • 1S101 ( ''cotA''::''cat''), [Pubmed|2821284], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S101&Search=1S101 BGSC]
  • 1S134 ( ''cotA''::''kan''), [Pubmed|11514528], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S134&Search=1S134 BGSC]
  • BKE06300 ([gene|73473E6556D374C8623A426E075038AD01AB7025|cotA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCATCTGTCCTTATC, downstream forward: _UP4_TAACCCGACAAACTTGCCTC
  • BKK06300 ([gene|73473E6556D374C8623A426E075038AD01AB7025|cotA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCATCTGTCCTTATC, downstream forward: _UP4_TAACCCGACAAACTTGCCTC
  • References

    Reviews

  • 23202530
  • Original publications

  • 15699190,3135411,11514528,1518043,2821284,19933362,20200715,20551082,20822511,21369750,22281748,23859715,22171814,22410485,15383836,26062535,24293734,24733162,25259857,25847445,26784443,27050268,28870294,29301022