SubtiBank SubtiBank
yflS [2019-01-04 11:32:28]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yflS [2019-01-04 11:32:28]

malate transporter
51.27 kDa
protein length
478 aa Sequence Blast
gene length
1434 bp Sequence Blast
malate uptake
malate transporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Transporter for organic acids]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of organic acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    829,382 → 830,818


    additional information

  • the mRNA is stabilized by basepairing with the RoxS RNA [pubmed|28436820]
  • non-protected mRNA is subject to degradation by by [SW|rnjA|RNase J1] [pubmed|28436820]
  • The protein

    Catalyzed reaction/ biological activity

  • uptake of malate
  • Expression and Regulation



    regulatory mechanism

  • [protein|689CF50691E77E5A40437EF1E6B5083AF7CFCE08|MalR]: activation, in [regulon|689CF50691E77E5A40437EF1E6B5083AF7CFCE08|MalR regulon]
  • regulation

  • induced by malate ([protein|689CF50691E77E5A40437EF1E6B5083AF7CFCE08|MalR])
  • additional information

  • the mRNA is substantially stabilized upon depletion of [SW|Rny|RNase Y ][PubMed|21815947]
  • the mRNA is stabilized by basepairing with the [protein|search|RoxS ]RNA [pubmed|28436820]
  • non-protected mRNA is subject to degradation by by [SW|rnjA|RNase J1] [pubmed|28436820]
  • view in new tab

    Biological materials


  • MGNA-C249 (yflS::erm), available at the [ NBRP B. subtilis, Japan]
  • GP1450 (cat), available in [SW|Jörg Stülke]'s lab
  • BKE07570 (Δ[gene|73356B73D6C89D6569CECCC7295AF85CC7A1E6E3|yflS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAATAGGTCTCCTCCTA, downstream forward: _UP4_TAGAAAGAAAAAGGCAGACG
  • BKK07570 (Δ[gene|73356B73D6C89D6569CECCC7295AF85CC7A1E6E3|yflS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAATAGGTCTCCTCCTA, downstream forward: _UP4_TAGAAAGAAAAAGGCAGACG
  • References

  • 12949159,21815947,28436820,29651979