SubtiBank SubtiBank
yflS [2018-04-15 14:02:37]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yflS [2018-04-15 14:02:37]

malate transporter
locus
BSU07570
pI
9.74
mw
51.27 kDa
protein length
478 aa Sequence Blast
gene length
1434 bp Sequence Blast
function
malate uptake
product
malate transporter
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.4|Transporter for organic acids]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    829,382 → 830,818

    RNA

    additional information

  • the mRNA is stabilized by basepairing with the RoxS RNA [pubmed|28436820]
  • non-protected mRNA is subject to degradation by by [SW|rnjA|RNase J1] [pubmed|28436820]
  • Protein

    Catalyzed reaction/ biological activity

  • uptake of malate
  • Protein family

  • View classification (according to Swiss-Prot)
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|73356B73D6C89D6569CECCC7295AF85CC7A1E6E3|yflS]
    description
    [Pubmed|21815947]

    regulatory mechanism

  • [protein|689CF50691E77E5A40437EF1E6B5083AF7CFCE08|MalR]: activation, in [regulon|689CF50691E77E5A40437EF1E6B5083AF7CFCE08|MalR regulon]
  • regulation

  • induced by malate ([protein|689CF50691E77E5A40437EF1E6B5083AF7CFCE08|MalR])
  • additional information

  • the mRNA is substantially stabilized upon depletion of [SW|Rny|RNase Y ][PubMed|21815947]
  • the mRNA is stabilized by basepairing with the [protein|search|RoxS ]RNA [pubmed|28436820]
  • non-protected mRNA is subject to degradation by by [SW|rnjA|RNase J1] [pubmed|28436820]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C249 (yflS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2247 NBRP B. subtilis, Japan]
  • GP1450 (cat), available in [SW|Jörg Stülke]'s lab
  • BKE07570 (Δ[gene|73356B73D6C89D6569CECCC7295AF85CC7A1E6E3|yflS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAATAGGTCTCCTCCTA, downstream forward: _UP4_TAGAAAGAAAAAGGCAGACG
  • BKK07570 (Δ[gene|73356B73D6C89D6569CECCC7295AF85CC7A1E6E3|yflS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAATAGGTCTCCTCCTA, downstream forward: _UP4_TAGAAAGAAAAAGGCAGACG
  • References

  • 12949159,21815947,28436820