SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


malate transporter
51.27 kDa
protein length
478 aa Sequence Blast
gene length
1437 bp Sequence Blast
malate uptake
malate transporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Transporter for organic acids]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of organic acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    829,382 830,818


    additional information

  • the mRNA is stabilized by basepairing with the RoxS RNA [pubmed|28436820]
  • non-protected mRNA is subject to degradation by by [SW|rnjA|RNase J1] [pubmed|28436820]
  • The protein

    Catalyzed reaction/ biological activity

  • uptake of malate
  • Protein family

  • SLC13A/DASS transporter (TC 2.A.47) family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • spore membrane [pubmed|30602489]
  • Expression and Regulation



    regulatory mechanism

  • [protein|689CF50691E77E5A40437EF1E6B5083AF7CFCE08|MalR]: activation, in [regulon|689CF50691E77E5A40437EF1E6B5083AF7CFCE08|MalR regulon]
  • regulation

  • induced by malate ([protein|689CF50691E77E5A40437EF1E6B5083AF7CFCE08|MalR])
  • additional information

  • the mRNA is substantially stabilized upon depletion of [SW|Rny|RNase Y ][PubMed|21815947]
  • the mRNA is stabilized by basepairing with the [protein|search|RoxS ]RNA [pubmed|28436820]
  • non-protected mRNA is subject to degradation by by [SW|rnjA|RNase J1] [pubmed|28436820]
  • view in new tab

    Biological materials


  • MGNA-C249 (yflS::erm), available at the [ NBRP B. subtilis, Japan]
  • GP1450 (cat), available in [SW|Jörg Stülke]'s lab
  • BKE07570 ([gene|73356B73D6C89D6569CECCC7295AF85CC7A1E6E3|yflS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAATAGGTCTCCTCCTA, downstream forward: _UP4_TAGAAAGAAAAAGGCAGACG
  • BKK07570 ([gene|73356B73D6C89D6569CECCC7295AF85CC7A1E6E3|yflS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAATAGGTCTCCTCCTA, downstream forward: _UP4_TAGAAAGAAAAAGGCAGACG
  • References

  • 12949159,21815947,28436820,29651979,30602489