SubtiBank SubtiBank
yvfS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvfS

similar to [SW|ABC transporter] (transmembrane subunit)
locus
BSU_34080
pI
9.76
mw
27.78 kDa
protein length
245 aa Sequence Blast
gene length
738 bp Sequence Blast
function
unknown
product
[SW|ABC transporter] (transmembrane subunit)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.2|Exporters] → [category|SW 1.2.1.2.6|Exporters of unknown function]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,497,614 3,498,351

    The protein

    Protein family

  • [SW|ABC-2 integral membrane protein family] (according to UniProt)
  • [SW|Domains]

  • [SW|ABC transmembrane type-2 domain] (aa 20-242) (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|B6BBB827CB475423FC9A781058141B7D05C4D284|yvfR]-[gene|72E387D5D44FA20D6EEFF1B39B6C9F322F966FC5|yvfS]
    description
    [Pubmed|26647299]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A482 (yvfS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/482 NBRP B. subtilis, Japan]
  • BKE34080 ([gene|72E387D5D44FA20D6EEFF1B39B6C9F322F966FC5|yvfS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTTTGCTTTTGCAGCACGT, downstream forward: _UP4_AGAAAACAAGAAGCGGTGTA
  • BKK34080 ([gene|72E387D5D44FA20D6EEFF1B39B6C9F322F966FC5|yvfS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTTTGCTTTTGCAGCACGT, downstream forward: _UP4_AGAAAACAAGAAGCGGTGTA
  • References

  • 10092453,26647299,28461449